SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


2-methylthio-N6-threonylcarbamoyladenosine cyclase, catalyzes ATP-dependent dehydration of 2-methylthio N6-threonylcarbamoyladenosine (t6A) to form 2-methylthio cyclic N6-threonylcarbamoyladenosine (ms2ct6A )
28.02 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
tRNA modification
2-methylthio-N6-threonylcarbamoyladenosine cyclase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    2,813,643 2,814,407

    The protein

    Catalyzed reaction/ biological activity

  • catalyzes ATP-dependent dehydration of 2-methylthio N6-threonylcarbamoyladenosine (t6A) to form 2-methylthio cyclic N6-threonylcarbamoyladenosine (ms2ct6A ) [Pubmed|27913733,23242255]
  • Protein family

  • HesA/MoeB/ThiF family (with [protein|C163CF34BAA3A37DCC67851DEE5889BB7AD208AB|MoeB] and [protein|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|ThiF], according to UniProt)
  • Structure

  • [PDB|4D7A] (from ''E. coli'', 40% identity) [Pubmed|25897750]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A826 (yrvM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27540 ([gene|37DA3A036937660AA750065B46B581D911D73D00|yrvM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAACCTCACTCCACATT, downstream forward: _UP4_TAATGCATAAAAACAGCCTT
  • BKK27540 ([gene|37DA3A036937660AA750065B46B581D911D73D00|yrvM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAACCTCACTCCACATT, downstream forward: _UP4_TAATGCATAAAAACAGCCTT
  • References

  • 23242255,27913733,25897750