SubtiBank SubtiBank
yrvM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrvM

2-methylthio-N6-threonylcarbamoyladenosine cyclase, catalyzes ATP-dependent dehydration of 2-methylthio N6-threonylcarbamoyladenosine (t6A) to form 2-methylthio cyclic N6-threonylcarbamoyladenosine (ms2ct6A )
locus
BSU_27540
pI
8.19
mw
28.02 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
tRNA modification
product
2-methylthio-N6-threonylcarbamoyladenosine cyclase
essential
no
synonyms
yrvM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    2,813,643 2,814,407

    The protein

    Catalyzed reaction/ biological activity

  • catalyzes ATP-dependent dehydration of 2-methylthio N6-threonylcarbamoyladenosine (t6A) to form 2-methylthio cyclic N6-threonylcarbamoyladenosine (ms2ct6A ) [Pubmed|27913733,23242255]
  • Protein family

  • HesA/MoeB/ThiF family (with [protein|C163CF34BAA3A37DCC67851DEE5889BB7AD208AB|MoeB] and [protein|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|ThiF], according to UniProt)
  • Structure

  • [PDB|4D7A] (from ''E. coli'', 40% identity) [Pubmed|25897750]
  • Expression and Regulation

    Operons

    genes
    [gene|A0E4AC7E74B5374198D047589629DA96A681CAF4|bsrB]-[gene|37DA3A036937660AA750065B46B581D911D73D00|yrvM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A826 (yrvM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/826 NBRP B. subtilis, Japan]
  • BKE27540 ([gene|37DA3A036937660AA750065B46B581D911D73D00|yrvM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAACCTCACTCCACATT, downstream forward: _UP4_TAATGCATAAAAACAGCCTT
  • BKK27540 ([gene|37DA3A036937660AA750065B46B581D911D73D00|yrvM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAACCTCACTCCACATT, downstream forward: _UP4_TAATGCATAAAAACAGCCTT
  • References

  • 23242255,27913733,25897750