SubtiBank SubtiBank
hpf
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hpf

general stress protein, required for ribosome dimerization in the stationary phase, required for protection against paraquat stress
locus
BSU35310
pI
5.18
mw
21.83 kDa
protein length
189 aa Sequence Blast
gene length
570 bp Sequence Blast
function
dimerization of ribosomes in the stationary phase, protection against paraquat stress
product
ribosome hibernation promoting factor
essential
no
synonyms
yviI,yvyD

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,631,003 3,631,572

    Phenotypes of a mutant

  • the mutant is cold-sensitive
  • delayed recovery from stationary phase and delayed [SW|germination] [Pubmed|26743942]
  • The protein

    Catalyzed reaction/ biological activity

  • [protein|search|Hpf ]binds the 30S subunits of hibernating [SW|ribosome]s, dimerization of [protein|search|Hpf ]results in 100S [SW|ribosome ]dimer formation [pubmed|28468753,26743942]
  • Protein family

  • HPF/YfiA ribosome-associated protein family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-6 [Pubmed|22517742]
  • Structure

  • [PDB|2YWQ] (N-terminal domain, from ''Thermus thermophilus'', 32% identity)
  • [PDB|3K2T] (C-terminal domain, from ''Listeria monocytogenes'', 75% identity)
  • [PDB|5NJT] (Hpf as part of the 100S [SW|ribosome]) [pubmed|28468753]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]-[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]-[gene|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|fliS]-[gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]-[gene|A6E7212D159F076F5D26F9C02F340B40C3667623|smiA]-[gene|06FEA5F205B40DD5CF8D9F1328E940D4543F4741|S1350]-[gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    genes
    [gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]
    description
    [Pubmed|9852014]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|9852014,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|9852014], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|25666134], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed in the stationary phase [Pubmed|26743942]
  • view in new tab

    Biological materials

    Mutant

  • BKE35310 ([gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAGAACGCCTCCCTT, downstream forward: _UP4_TAATGAAGAGAAGCCTTCCG
  • BKK35310 ([gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAGAACGCCTCCCTT, downstream forward: _UP4_TAATGAAGAGAAGCCTTCCG
  • GP2598 ([gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab
  • References

  • 22517742,26743942,9852014,15805528,25666134,12107147,23663662,28468753,28468753,30619132