SubtiBank SubtiBank
hpf
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

hpf

general stress protein, required for ribosome dimerization in the stationary phase, protects essential ribosomal proteins ([protein|F1969E4C7BAAF70BCBE570F58350C12A3E417539|S2] and [protein|E7F4E01A6005C8469EAC64E8DFED96D0F29791A9|S3])
locus
BSU_35310
pI
5.18
mw
21.83 kDa
protein length
189 aa Sequence Blast
gene length
570 bp Sequence Blast
function
protection of essential ribosomal proteins ([protein|F1969E4C7BAAF70BCBE570F58350C12A3E417539|S2] and [protein|E7F4E01A6005C8469EAC64E8DFED96D0F29791A9|S3])
product
ribosome hibernation promoting factor
essential
no
synonyms
yviI,yvyD

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,631,003 3,631,572

    Phenotypes of a mutant

  • the mutant is cold-sensitive
  • delayed recovery from stationary phase and delayed [SW|germination] [Pubmed|26743942]
  • The protein

    Catalyzed reaction/ biological activity

  • [protein|search|Hpf ]binds the 30S subunits of hibernating [SW|ribosome]s, dimerization of [protein|search|Hpf ]results in 100S [SW|ribosome ]dimer formation [pubmed|28468753,26743942]
  • Protein family

  • HPF/YfiA ribosome-associated protein family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-6 [Pubmed|22517742]
  • Structure

  • [PDB|2YWQ] (N-terminal domain, from ''Thermus thermophilus'', 32% identity)
  • [PDB|3K2T] (C-terminal domain, from ''Listeria monocytogenes'', 75% identity)
  • [PDB|5NJT] (Hpf as part of the 100S [SW|ribosome]) [pubmed|28468753]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]-[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]-[gene|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|fliS]-[gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]-[gene|A6E7212D159F076F5D26F9C02F340B40C3667623|smiA]-[gene|06FEA5F205B40DD5CF8D9F1328E940D4543F4741|S1350]-[gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    genes
    [gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]
    description
    [Pubmed|9852014]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|9852014,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|9852014], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|25666134], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed in the stationary phase [Pubmed|26743942]
  • view in new tab

    Biological materials

    Mutant

  • BKE35310 ([gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAGAACGCCTCCCTT, downstream forward: _UP4_TAATGAAGAGAAGCCTTCCG
  • BKK35310 ([gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAGAACGCCTCCCTT, downstream forward: _UP4_TAATGAAGAGAAGCCTTCCG
  • GP2598 ([gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab
  • References

  • 22517742,26743942,9852014,15805528,25666134,12107147,23663662,28468753,28468753,30619132,31604775,32123037