SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


acetoine/ butanediol dehydrogenase
37.19 kDa
protein length
346 aa Sequence Blast
gene length
1041 bp Sequence Blast
overflow metabolism, fermentation
acetoine/ butanediol dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Overflow metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    677,911 678,951

    The protein

    Catalyzed reaction/ biological activity

  • formation of butanediol from acetoin [Pubmed|18820069]
  • Protein family

  • [SW|zinc-containing alcohol dehydrogenase family] (according to UniProt)
  • Modification

  • phosphorylated on Arg-13 [Pubmed|22517742]
  • [SW|Cofactors]

  • NAD+ (according to UniProt)
  • Structure

  • [PDB|4EJ6] (from ''Sinorhizobium meliloti'', 33% identity)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-C219 (ydjL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06240 ([gene|37A9CD057DC311397B9A5757F6ED7AE6998F6D5D|bdhA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGATTACCACTCCTATA, downstream forward: _UP4_TAATTTGAAACCAAAAAGAA
  • BKK06240 ([gene|37A9CD057DC311397B9A5757F6ED7AE6998F6D5D|bdhA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGATTACCACTCCTATA, downstream forward: _UP4_TAATTTGAAACCAAAAAGAA
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 18820069,22361854,22517742,22178965,20817675,23576037,15378759,24608678,26385762,26825987,28426331,29512378