SubtiBank SubtiBank
bdhA

bdhA

acetoine/ butanediol dehydrogenase
locus
BSU_06240
pI
4.80
mw
37.19 kDa
protein length
346 aa Sequence Blast
gene length
1041 bp Sequence Blast
function
overflow metabolism, fermentation
product
acetoine/ butanediol dehydrogenase
essential
no
synonyms
ydjL

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.5|Overflow metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    677,911 678,951

    The protein

    Catalyzed reaction/ biological activity

  • formation of butanediol from acetoin [Pubmed|18820069]
  • (R,R)-butane-2,3-diol + NAD+ --> (R)-acetoin + H+ + NADH (according to UniProt)
  • Protein family

  • [SW|zinc-containing alcohol dehydrogenase family] (according to UniProt)
  • Modification

  • phosphorylated on Arg-13 [Pubmed|22517742]
  • [SW|Cofactors]

  • NAD+ (according to UniProt)
  • Structure

  • [PDB|6IE0]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|37A9CD057DC311397B9A5757F6ED7AE6998F6D5D|bdhA]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C219 (ydjL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2217 NBRP B. subtilis, Japan]
  • BKE06240 ([gene|37A9CD057DC311397B9A5757F6ED7AE6998F6D5D|bdhA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGATTACCACTCCTATA, downstream forward: _UP4_TAATTTGAAACCAAAAAGAA
  • BKK06240 ([gene|37A9CD057DC311397B9A5757F6ED7AE6998F6D5D|bdhA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGATTACCACTCCTATA, downstream forward: _UP4_TAATTTGAAACCAAAAAGAA
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 18820069,22361854,22517742,22178965,20817675,23576037,15378759,24608678,26385762,26825987,28426331,29512378