SubtiBank SubtiBank
yoaD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoaD

similar to phosphoglycerate dehydrogenase
locus
BSU18560
pI
5.62
mw
38.47 kDa
protein length
344 aa Sequence Blast
gene length
1035 bp Sequence Blast
function
methionine biosynthesis
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.11|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine/ based on similarity]
  • Gene

    Coordinates
    2,024,042 2,025,076

    The protein

    Catalyzed reaction/ biological activity

  • YoaD is likely to convert 3-phosphoglycerate to serine for use in methionine biosynthesis (based on [protein|search|S-box] regulation)
  • Structure

  • [PDB|1WWK] (phosphoglycerate dehydrogenase from Pyrococcus horikoshii, 35% identity)
  • Additional information

  • The gene is annotated in KEGG as an ortholog of D-3-phosphoglycerate dehydrogenase EC 1.1.1.95. No EC annotation is available in Swiss-Prot. In MetaCyc the protein is marked as similar to phosphorglycerate dehydrogenase. No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD]-[gene|182B8EFA41DAE695B008CBAA561F3730D11750B1|yoaC]-[gene|FF60633F2902E4CA58B34FF3DAFF85B0D4007622|yoaB]
    description
    [Pubmed|10094622]

    regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A835 (yoaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/835 NBRP B. subtilis, Japan]
  • BKE18560 ([gene|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAATCTCTTTCC, downstream forward: _UP4_TAAGAAAGGAGGCTAACAGA
  • BKK18560 ([gene|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAATCTCTTTCC, downstream forward: _UP4_TAAGAAAGGAGGCTAACAGA
  • References

  • 19258532,10094622,12107147,18039762,29794222