SubtiBank SubtiBank
yoaD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoaD

similar to phosphoglycerate dehydrogenase
locus
BSU_18560
pI
5.62
mw
38.47 kDa
protein length
344 aa Sequence Blast
gene length
1035 bp Sequence Blast
function
methionine biosynthesis
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.11|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine/ based on similarity]
  • Gene

    Coordinates
    2,024,042 2,025,076

    The protein

    Catalyzed reaction/ biological activity

  • YoaD is likely to convert 3-phosphoglycerate to serine for use in methionine biosynthesis (based on [protein|search|S-box] regulation)
  • Protein family

  • D-isomer specific 2-hydroxyacid dehydrogenase family (with [protein|B0145F4E13F004ECC773E8758B5844669F4C74D7|YvcT] and [protein|8AD1C7C761FF8B407A973381CA135C264B995CB7|SerA], according to UniProt)
  • Structure

  • [PDB|1WWK] (phosphoglycerate dehydrogenase from Pyrococcus horikoshii, 35% identity)
  • Additional information

  • The gene is annotated in KEGG as an ortholog of D-3-phosphoglycerate dehydrogenase EC 1.1.1.95. No EC annotation is available in Swiss-Prot. In MetaCyc the protein is marked as similar to phosphorglycerate dehydrogenase. No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD]-[gene|182B8EFA41DAE695B008CBAA561F3730D11750B1|yoaC]-[gene|FF60633F2902E4CA58B34FF3DAFF85B0D4007622|yoaB]
    description
    [Pubmed|10094622]

    regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A835 (yoaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/835 NBRP B. subtilis, Japan]
  • BKE18560 ([gene|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAATCTCTTTCC, downstream forward: _UP4_TAAGAAAGGAGGCTAACAGA
  • BKK18560 ([gene|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAATCTCTTTCC, downstream forward: _UP4_TAAGAAAGGAGGCTAACAGA
  • References

  • 19258532,10094622,12107147,18039762,29794222