SubtiBank SubtiBank
lepA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

lepA

elongation factor 4, GTP-binding protein
locus
BSU_25510
pI
4.98
mw
68.41 kDa
protein length
612 aa Sequence Blast
gene length
1839 bp Sequence Blast
function
translation elongation
product
elongation factor 4
essential
no
synonyms
yqxB,yqeQ

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.3|GTP-binding proteins]
  • Gene

    Coordinates
    2,630,910 2,632,748

    The protein

    Catalyzed reaction/ biological activity

  • GTP + H2O --> GDP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|TRAFAC class translation factor GTPase superfamily] (according to UniProt)
  • [SW|Classic translation factor GTPase family] (according to UniProt)
  • [SW|Domains]

  • [SW|tr-type G domain] (aa 12-194) (according to UniProt)
  • Structure

  • [PDB|4QJT] (LepA bound to the ''Thermus thermophilus'' ribosome, 62% identity) [Pubmed|25104389]
  • [SW|Localization]

  • cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|3744083E3BB30A64D15360A12636665F76C40327|lepA]-[gene|757C51296E198849EAC1FFA4D37121D9085930A8|hemN]
    description
    [Pubmed|8757728]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9371469], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • There is a terminator between '[protein|search|lepA]' and '[protein|search|hemN]' with only little readthrough
  • view in new tab

    Biological materials

    Mutant

  • BKE25510 ([gene|3744083E3BB30A64D15360A12636665F76C40327|lepA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATCTATCACTCCTACT, downstream forward: _UP4_TAGAAGCCGCCGCAGTCTTG
  • BKK25510 ([gene|3744083E3BB30A64D15360A12636665F76C40327|lepA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATCTATCACTCCTACT, downstream forward: _UP4_TAGAAGCCGCCGCAGTCTTG
  • References

  • 8757728,9371469,16479537,25378333,23662805,21300907,25491353,17307049, 25104389,17110332,18362332