SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


elongation factor 4, GTP-binding protein
68.41 kDa
protein length
612 aa Sequence Blast
gene length
1839 bp Sequence Blast
translation elongation
elongation factor 4

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.3|GTP-binding proteins]
  • Gene

    2,630,910 2,632,748

    The protein

    Catalyzed reaction/ biological activity

  • GTP + H2O --> GDP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|TRAFAC class translation factor GTPase superfamily] (according to UniProt)
  • [SW|Classic translation factor GTPase family] (according to UniProt)
  • [SW|Domains]

  • [SW|tr-type G domain] (aa 12-194) (according to UniProt)
  • Structure

  • [PDB|4QJT] (LepA bound to the ''Thermus thermophilus'' ribosome, 62% identity) [Pubmed|25104389]
  • [SW|Localization]

  • cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9371469], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • There is a terminator between '[protein|search|lepA]' and '[protein|search|hemN]' with only little readthrough
  • view in new tab

    Biological materials


  • BKE25510 ([gene|3744083E3BB30A64D15360A12636665F76C40327|lepA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATCTATCACTCCTACT, downstream forward: _UP4_TAGAAGCCGCCGCAGTCTTG
  • BKK25510 ([gene|3744083E3BB30A64D15360A12636665F76C40327|lepA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATCTATCACTCCTACT, downstream forward: _UP4_TAGAAGCCGCCGCAGTCTTG
  • References

  • 8757728,9371469,16479537,25378333,23662805,21300907,25491353,17307049, 25104389,17110332,18362332