SubtiBank SubtiBank
ydeA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydeA

glyoxalase III-like enzyme
locus
BSU_05110
pI
5.64
mw
22.31 kDa
protein length
197 aa Sequence Blast
gene length
594 bp Sequence Blast
function
detoxification of methylglyoxal
product
glyoxalase III-like enzyme
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    558,408 559,001

    The protein

    Catalyzed reaction/ biological activity

  • methylglyoxal - D-lactate [Pubmed|24330391]
  • Protein family

  • [SW|peptidase C56 family] (according to UniProt)
  • [SW|Domains]

  • [SW|PfpI endopeptidase domain] (aa 29-166) (according to UniProt)
  • Structure

  • [PDB|3F5D]
  • Biological materials

    Mutant

  • MGNA-C128 (ydeA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2126 NBRP B. subtilis, Japan]
  • BKE05110 ([gene|36F6585A2EB990FE06A09AC56F2DB4E67CAEEE28|ydeA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAACTATATACCGCCTTA, downstream forward: _UP4_TAATTTGCTGGAAATGATTT
  • BKK05110 ([gene|36F6585A2EB990FE06A09AC56F2DB4E67CAEEE28|ydeA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAACTATATACCGCCTTA, downstream forward: _UP4_TAATTTGCTGGAAATGATTT
  • References

  • 24330391