SubtiBank SubtiBank
yocB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yocB

general stress protein, survival of stress conditions
locus
BSU19150
pI
5.66
mw
30.04 kDa
protein length
260 aa Sequence Blast
gene length
783 bp Sequence Blast
function
survival of stress conditions
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,086,743 2,087,525

    The protein

    [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|36B039D1D8CCCC47FAAA2F236E05A8D6669F14F3|yocB]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A325 (yocB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/325 NBRP B. subtilis, Japan]
  • BKE19150 ([gene|36B039D1D8CCCC47FAAA2F236E05A8D6669F14F3|yocB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGATTCCTCCTTTTT, downstream forward: _UP4_TAAACCTAACAGGCCGGGGC
  • BKK19150 ([gene|36B039D1D8CCCC47FAAA2F236E05A8D6669F14F3|yocB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGATTCCTCCTTTTT, downstream forward: _UP4_TAAACCTAACAGGCCGGGGC
  • References

  • 15805528