SubtiBank SubtiBank
yrhD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrhD

unknown
locus
BSU_27230
pI
4.76
mw
17.37 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,784,170 2,784,652

    Expression and Regulation

    Operons

    genes
    [gene|A4304213CFC152B601B2EED2B9B3A0A3AB4E6A81|yrhE]-[gene|364BC3B51D8DF152C2DF31046D4F80595C75884B|yrhD]
    description
    [Pubmed|21815947]

    additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yrhE'' [Pubmed|27120414]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A150 (yrhD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/150 NBRP B. subtilis, Japan]
  • BKE27230 ([gene|364BC3B51D8DF152C2DF31046D4F80595C75884B|yrhD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCCATTCGTTTTCCTCCTA, downstream forward: _UP4_TAACAGAAAAACAGCCATCT
  • BKK27230 ([gene|364BC3B51D8DF152C2DF31046D4F80595C75884B|yrhD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCCATTCGTTTTCCTCCTA, downstream forward: _UP4_TAACAGAAAAACAGCCATCT
  • References

  • 21815947