SubtiBank SubtiBank
yqbC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbC

unknown
locus
BSU_26160
pI
5.16
mw
25.10 kDa
protein length
217 aa Sequence Blast
gene length
654 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,685,162 2,685,815

    Expression and Regulation

    Operons

    genes
    [gene|35CEFA2C43B039921C86F4ABB56CFF98E84B7D73|yqbC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE26160 ([gene|35CEFA2C43B039921C86F4ABB56CFF98E84B7D73|yqbC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCCCACCTAATA, downstream forward: _UP4_TAGAAGTCTTTTCTTATTTT
  • BKK26160 ([gene|35CEFA2C43B039921C86F4ABB56CFF98E84B7D73|yqbC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCCCACCTAATA, downstream forward: _UP4_TAGAAGTCTTTTCTTATTTT