SubtiBank SubtiBank
sspF
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

sspF

small acid-soluble spore protein (minor)
locus
BSU_00450
pI
9.65
mw
6.89 kDa
protein length
gene length
186 bp Sequence Blast
function
protection of spore DNA
product
small acid-soluble spore protein (minor)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.3|Small acid-soluble spore proteins]
  • Gene

    Coordinates
    53,183 53,368

    The protein

    Protein family

  • [SW|Alpha/beta-type SASP family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|358EACB735F46F7DBA2F2A132177939D80140477|sspF]
    description
    [Pubmed|6205155]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,6205155], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • switched on during stage III of sporulation [Pubmed|6205155]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials

    Mutant

  • BKE00450 ([gene|358EACB735F46F7DBA2F2A132177939D80140477|sspF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACGAAACAACTCCTTTT, downstream forward: _UP4_AACCGATAAGGATGTGACCC
  • BKK00450 ([gene|358EACB735F46F7DBA2F2A132177939D80140477|sspF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACGAAACAACTCCTTTT, downstream forward: _UP4_AACCGATAAGGATGTGACCC
  • References

  • 8982008,6205155,30782632