SubtiBank SubtiBank
alsD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

alsD

acetolactate decarboxylase
locus
BSU_36000
pI
4.60
mw
28.65 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
function
overflow metabolism
product
acetolactate decarboxylase
essential
no
ec
4.1.1.5
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.5|Overflow metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    3,708,799 3,709,566

    Phenotypes of a mutant

  • reduced acetoin production [pubmed|31113899]
  • impaired biofilm development [pubmed|31113899]
  • The protein

    Catalyzed reaction/ biological activity

  • (2S)-2-acetolactate + H+ --> (R)-acetoin + CO2 (according to UniProt)
  • Protein family

  • alpha-acetolactate decarboxylase family (single member, according to UniProt)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705], ''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] on Ser-88 [Pubmed|20389117]
  • Structure

  • [PDB|5XNE] [pubmed|29796971]
  • Expression and Regulation

    Operons

    genes
    [gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]-[gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD]
    description
    [Pubmed|7685336]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7685336], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8BA7714236EBFDBB9987F1DACC9775AD974C743E|AlsR]: activation, in the presence of acetate [Pubmed|7685336], in [regulon|8BA7714236EBFDBB9987F1DACC9775AD974C743E|AlsR regulon]
  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, if the ratio NADH2/NAD is high [Pubmed|16428414], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • [regulon|stringent response|stringent response]: positive regulation, due to presence of adenines at +1 and +2 positions of the transcript [Pubmed|20081037], in [regulon|stringent response|stringent response]
  • regulation

  • induction by acetate ([protein|8BA7714236EBFDBB9987F1DACC9775AD974C743E|AlsR]) [Pubmed|30039521,7685336]
  • expression is heterogeneous [pubmed|29809139]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • BKE36000 ([gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCCTTCACTCCTT, downstream forward: _UP4_TAAAAGAAAAAAAGAAAGCC
  • BKK36000 ([gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCCTTCACTCCTT, downstream forward: _UP4_TAAAAGAAAAAAAGAAAGCC
  • Expression vectors

  • for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP822, available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
  • References

  • 19087206,10986270,16428414,16493705,7685336,16428414,20081037,20389117,24734205,22178965,29809139,29796971,23985082,30039521,31113899