SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


5.51 kDa
protein length
gene length
162 bp Sequence Blast
regulation of tryptophan biosynthesis

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • Gene

    277,160 277,321

    The protein


  • [PDB|1N53] (structure of T box RNA), [PDB|2BX9], [PDB|2ZP9] (complex with [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB])
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10706627], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: transcription termination/ antitermination, [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB] [pubmed|10706627], in [regulon|T-box|T-box]
  • regulation

  • ''[protein|search|rtpA]'': induced by tryptophan limitation ([protein|search|T-box] in the mRNA leader) [Pubmed|10706627]
  • view in new tab

    Biological materials


  • BKE02530 ([gene|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|rtpA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATATCCTCCTTTCT, downstream forward: _UP4_TAAAGGAGAAAAGCTGAGCT
  • BKK02530 ([gene|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|rtpA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATATCCTCCTTTCT, downstream forward: _UP4_TAAAGGAGAAAAGCTGAGCT
  • References


  • 16285852,19258532
  • Original Publications

  • 15213402,16306262,15099736,15743934,11786553,11566976,15023340,18178730,12386162,11557884,10706627,18334255,12855807,20713740,24682818