SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


manganese transporter (proton symport)
45.52 kDa
protein length
425 aa Sequence Blast
gene length
1278 bp Sequence Blast
manganese uptake
manganese transporter (proton symport))

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Manganese]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    491,147 492,424

    Phenotypes of a mutant

  • suppresses the Mn2+ sensitivity of a [gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR] mutant [pubmed|31964700]
  • The protein

    Catalyzed reaction/ biological activity

  • export of Mn2+
  • Protein family

  • NRAMP family (with [protein|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|YcsG], according to UniProt)
  • Structure

  • [PDB|4WGV] (from ''Staphylococcus capitis'', 40% identity) [Pubmed|25326704]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR]: repression, [Pubmed|10760146], in [regulon|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR regulon]
  • regulation

  • repressed at high Mn(II) concentrations (MntR) [Pubmed|10760146]
  • view in new tab

    Biological materials


  • MGNA-C116 (ydaR::erm), available at the [ NBRP B. subtilis, Japan]
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04360 ([gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCACCTGAATTCTG, downstream forward: _UP4_TAAAAAAACCGGCTTCTAAA
  • BKK04360 ([gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCACCTGAATTCTG, downstream forward: _UP4_TAAAAAAACCGGCTTCTAAA
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References

  • 10760146,12950915,10760146,25326704,31964700