SubtiBank SubtiBank
mntH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mntH

manganese transporter (proton symport)
locus
BSU_04360
pI
9.89
mw
45.52 kDa
protein length
425 aa Sequence Blast
gene length
1278 bp Sequence Blast
function
manganese uptake
product
manganese transporter (proton symport))
essential
no
synonyms
ydaR

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.2|Manganese]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    491,147 492,424

    The protein

    Protein family

  • NRAMP family (with [protein|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|YcsG], according to UniProt)
  • Structure

  • [PDB|4WGV] (from ''Staphylococcus capitis'', 40% identity) [Pubmed|25326704]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH]
    description
    [Pubmed|10760146]

    regulatory mechanism

  • [protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR]: repression, [Pubmed|10760146], in [regulon|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR regulon]
  • regulation

  • repressed at high Mn(II) concentrations (MntR) [Pubmed|10760146]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C116 (ydaR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2114 NBRP B. subtilis, Japan]
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04360 ([gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCACCTGAATTCTG, downstream forward: _UP4_TAAAAAAACCGGCTTCTAAA
  • BKK04360 ([gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCACCTGAATTCTG, downstream forward: _UP4_TAAAAAAACCGGCTTCTAAA
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

  • 10760146,12950915,10760146,25326704