SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


manganese transporter (proton symport)
45.52 kDa
protein length
425 aa Sequence Blast
gene length
1278 bp Sequence Blast
manganese uptake
manganese transporter (proton symport))

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Manganese]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    491,147 492,424

    Phenotypes of a mutant

  • suppresses the Mn2+ sensitivity of a [gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR] mutant [pubmed|31964700]
  • The protein

    Catalyzed reaction/ biological activity

  • export of Mn2+
  • Protein family

  • NRAMP family (with [protein|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|YcsG], according to UniProt)
  • Structure

  • [PDB|4WGV] (from ''Staphylococcus capitis'', 40% identity) [Pubmed|25326704]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR]: repression, [Pubmed|10760146], in [regulon|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR regulon]
  • regulation

  • repressed at high Mn(II) concentrations (MntR) [Pubmed|10760146]
  • view in new tab

    Biological materials


  • MGNA-C116 (ydaR::erm), available at the [ NBRP B. subtilis, Japan]
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04360 ([gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCACCTGAATTCTG, downstream forward: _UP4_TAAAAAAACCGGCTTCTAAA
  • BKK04360 ([gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCACCTGAATTCTG, downstream forward: _UP4_TAAAAAAACCGGCTTCTAAA
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References

  • 10760146,12950915,10760146,25326704,31964700