SubtiBank SubtiBank
adhA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

adhA

thiol-dependent aldehyde dehydrogenase, repair of damaged thiol-containing proteins
locus
BSU_27010
pI
5.37
mw
37.67 kDa
protein length
349 aa Sequence Blast
gene length
1050 bp Sequence Blast
function
response to toxic formaldehyde
product
thiol-dependent aldehyde dehydrogenase, reduction of aldehydes
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,756,312 2,757,361

    The protein

    Protein family

  • [SW|zinc-containing alcohol dehydrogenase family] (according to UniProt)
  • Structure

  • [PDB|1UUF] (from E. coli, 54% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|BEF882B7B846E3B8BF4C08FBF0DBB9F5A2CA2604|yrzP]-[gene|352544F3E79943E94E28A6EB5F4C543B529A02D1|adhA]-[gene|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|yraA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|352544F3E79943E94E28A6EB5F4C543B529A02D1|adhA]-[gene|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|yraA]
    description
    [Pubmed|19170879]

    regulatory mechanism

  • [protein|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|AdhR]: activation, [Pubmed|19170879], in [regulon|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|AdhR regulon]
  • regulation

  • ''[protein|search|adhA]'': induced in the presence of the toxic carbonyls methylglyoxal and formaldehyde ([protein|search|AdhR]) [Pubmed|19170879]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A260 (adhA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/260 NBRP B. subtilis, Japan]
  • BKE27010 ([gene|352544F3E79943E94E28A6EB5F4C543B529A02D1|adhA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGAACCTATCCTTTCT, downstream forward: _UP4_TAATAGGTTAGTCCTTATAT
  • BKK27010 ([gene|352544F3E79943E94E28A6EB5F4C543B529A02D1|adhA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGAACCTATCCTTTCT, downstream forward: _UP4_TAATAGGTTAGTCCTTATAT
  • References

  • 19170879