SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


thiol-dependent aldehyde dehydrogenase, repair of damaged thiol-containing proteins
37.67 kDa
protein length
349 aa Sequence Blast
gene length
1050 bp Sequence Blast
response to toxic formaldehyde
thiol-dependent aldehyde dehydrogenase, reduction of aldehydes

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    2,756,312 2,757,361

    The protein

    Protein family

  • [SW|zinc-containing alcohol dehydrogenase family] (according to UniProt)
  • Structure

  • [PDB|1UUF] (from E. coli, 54% identity)
  • Expression and Regulation


    view in new tab


    regulatory mechanism

  • [protein|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|AdhR]: activation, [Pubmed|19170879], in [regulon|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|AdhR regulon]
  • regulation

  • ''[protein|search|adhA]'': induced in the presence of the toxic carbonyls methylglyoxal and formaldehyde ([protein|search|AdhR]) [Pubmed|19170879]
  • view in new tab

    Biological materials


  • MGNA-A260 (adhA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27010 ([gene|352544F3E79943E94E28A6EB5F4C543B529A02D1|adhA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGAACCTATCCTTTCT, downstream forward: _UP4_TAATAGGTTAGTCCTTATAT
  • BKK27010 ([gene|352544F3E79943E94E28A6EB5F4C543B529A02D1|adhA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGAACCTATCCTTTCT, downstream forward: _UP4_TAATAGGTTAGTCCTTATAT
  • References

  • 19170879