SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


35.34 kDa
protein length
315 aa Sequence Blast
gene length
948 bp Sequence Blast
glucomannan utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glucomannan]
  • Gene

    631,808 632,755

    The protein

    Catalyzed reaction/ biological activity

  • D-mannose 6-phosphate --> D-fructose 6-phosphate (according to UniProt)
  • Protein family

  • mannose-6-phosphate isomerase type 1 family (with [protein|E26C70893C5D677C816C814558CC42F90B920087|ManA] and [protein|AC79E2A80664B4D165A0AE46CEA124C57EB9770D|Pmi], according to UniProt)
  • Paralogous protein(s)

  • [protein|AC79E2A80664B4D165A0AE46CEA124C57EB9770D|Pmi], [protein|E26C70893C5D677C816C814558CC42F90B920087|ManA]
  • Structure

  • [PDB|1QWR] ([protein|AC79E2A80664B4D165A0AE46CEA124C57EB9770D|Pmi], 58% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18177310], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]: repression, [Pubmed|18177310], in [regulon|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18177310], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]) [Pubmed|18177310]
  • view in new tab

    Biological materials


  • MGNA-C194 (ydhS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05870 ([gene|35225776F6044513D3E77DBBD6A7A8FE976F506A|gmuF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTCTAAAAATAATGGAT, downstream forward: _UP4_CCTTAATGAATGGGGGAGTT
  • BKK05870 ([gene|35225776F6044513D3E77DBBD6A7A8FE976F506A|gmuF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTCTAAAAATAATGGAT, downstream forward: _UP4_CCTTAATGAATGGGGGAGTT
  • References

  • 18177310,19447949,20817675