SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


GMP reductase
35.66 kDa
protein length
326 aa Sequence Blast
gene length
981 bp Sequence Blast
purine salvage and interconversion
GMP reductase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Purine salvage and interconversion]
  • Gene

    3,303,042 3,304,022

    The protein

    Catalyzed reaction/ biological activity

  • Inosine 5'-phosphate + NH3 + NADP+ --> guanosine 5'-phosphate + NADPH (according to UniProt)
  • Protein family

  • IMPDH/GMPR family (together with [protein|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|GuaB]) (according to UniProt)
  • Structure

  • [PDB|1YPF] (from ''Bacillus anthracis'', 84% identity, 91% similarity)
  • Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • activated during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|12618455]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the mRNA increases from 3 to 20 min) [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-B573 (yumD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32130 ([gene|350A0C0D0ADB2A8E8DA9900E75A0D9914F18C665|guaC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTTTCACTCCTAAAA, downstream forward: _UP4_TAATCATAAAAAAACGCCAA
  • BKK32130 ([gene|350A0C0D0ADB2A8E8DA9900E75A0D9914F18C665|guaC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTTTCACTCCTAAAA, downstream forward: _UP4_TAATCATAAAAAAACGCCAA
  • References

  • 11591660,2536750,12618455,12850135,21815947