SubtiBank SubtiBank
ywqO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywqO

unknown
locus
BSU_36140
pI
10.06
mw
7.89 kDa
protein length
gene length
222 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,722,568 3,722,789

    Expression and Regulation

    Operons

    genes
    [gene|34E3F8DA2718E72321336B67F055F9D24544988B|ywqO]
    description
    [Pubmed|9353933]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A583 (ywqO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/583 NBRP B. subtilis, Japan]
  • BKE36140 ([gene|34E3F8DA2718E72321336B67F055F9D24544988B|ywqO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCAATGACCGACAGCAAAA, downstream forward: _UP4_TAAAAAAGCACCTGTCCAGG
  • BKK36140 ([gene|34E3F8DA2718E72321336B67F055F9D24544988B|ywqO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCAATGACCGACAGCAAAA, downstream forward: _UP4_TAAAAAAGCACCTGTCCAGG
  • References

  • 9353933