SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


two-component sensor kinase
17.85 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    279,059 279,994

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|60DA46B02BB5F71337AF5F34921E2E68EC062EC7|YcbL] (putative)
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine
  • [SW|Domains]

  • [SW|Histidine kinase domain] (aa 92-310) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • Structure

  • [PDB|5C93] ([protein|E88978809272FAC2520DB4ABCA0554F8028F3451|WalK] from Lactobacillus plantarum, 27% identity) [pubmed|28994408]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C035 (ycbM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02560 ([gene|348F81B6ECB6FFBEC092A672FF5F40FE86918872|ycbM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCGGCCACCCATAGCACTG, downstream forward: _UP4_TAATCGTAAGAATTTCTTAA
  • BKK02560 ([gene|348F81B6ECB6FFBEC092A672FF5F40FE86918872|ycbM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCGGCCACCCATAGCACTG, downstream forward: _UP4_TAATCGTAAGAATTTCTTAA
  • References

  • 10094672,28994408