SubtiBank SubtiBank
ypfB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypfB

unknown
locus
BSU_22900
pI
7.26
mw
6.92 kDa
protein length
gene length
177 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
jofB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,396,798 2,396,974

    The protein

    [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • view in new tab

    genes
    [gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]-[gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]-[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]-[gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]-[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A407 (ypfB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/407 NBRP B. subtilis, Japan]
  • BKE22900 ([gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGAGCACCTCCATTAC, downstream forward: _UP4_TAATTATTCATCAATTTTTC
  • BKK22900 ([gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGAGCACCTCCATTAC, downstream forward: _UP4_TAATTATTCATCAATTTTTC
  • References

  • 16497325