SubtiBank SubtiBank
yonO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yonO

SP DNA-dependent RNA polymerase
locus
BSU_21040
pI
9.06
mw
97.78 kDa
protein length
839 aa Sequence Blast
gene length
2520 bp Sequence Blast
function
transcription of late SP genes
product
SP RNA polymerase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.4|Prophage/ phage transcription]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,222,574 2,225,093

    The protein

    Catalyzed reaction/ biological activity

  • ribonucleoside 5'-triphosphate + RNA(n) --> diphosphate + RNA(n+1) (according to UniProt)
  • Protein family

  • YRH RNA polymerase family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|121C3C9CF49711316A526B9571F020BE8E304B31|yonP]-[gene|34380A2F469ACFD90D450717A41D6F5CC19DCD7E|yonO]-[gene|3FFFA28E2C16508C6A94408B739864DB7F8DD1F7|yonN]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE21040 ([gene|34380A2F469ACFD90D450717A41D6F5CC19DCD7E|yonO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAATTCTCCCCTTATT, downstream forward: _UP4_TAGAAAGTGCCTTGAGCCTT
  • BKK21040 ([gene|34380A2F469ACFD90D450717A41D6F5CC19DCD7E|yonO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAATTCTCCCCTTATT, downstream forward: _UP4_TAGAAAGTGCCTTGAGCCTT
  • References

    Reviews

  • 30578347
  • Research papers

  • 28585540