SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


SP DNA-dependent RNA polymerase
97.78 kDa
protein length
839 aa Sequence Blast
gene length
2520 bp Sequence Blast
transcription of late SP genes
SP RNA polymerase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Prophage/ phage transcription]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    2,222,574 2,225,093

    The protein

    Catalyzed reaction/ biological activity

  • ribonucleoside 5'-triphosphate + RNA(n) --> diphosphate + RNA(n+1) (according to UniProt)
  • Protein family

  • YRH RNA polymerase family (single member, according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE21040 ([gene|34380A2F469ACFD90D450717A41D6F5CC19DCD7E|yonO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAATTCTCCCCTTATT, downstream forward: _UP4_TAGAAAGTGCCTTGAGCCTT
  • BKK21040 ([gene|34380A2F469ACFD90D450717A41D6F5CC19DCD7E|yonO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAATTCTCCCCTTATT, downstream forward: _UP4_TAGAAAGTGCCTTGAGCCTT
  • References


  • 30578347
  • Research papers

  • 28585540