SubtiBank SubtiBank
yonO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yonO

SP DNA-dependent RNA polymerase
locus
BSU21040
pI
9.06
mw
97.78 kDa
protein length
839 aa Sequence Blast
gene length
2520 bp Sequence Blast
function
transcription of late SP genes
product
SP RNA polymerase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.4|Prophage/ phage transcription]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,222,574 2,225,093

    Expression and Regulation

    Operons

    genes
    [gene|121C3C9CF49711316A526B9571F020BE8E304B31|yonP]-[gene|34380A2F469ACFD90D450717A41D6F5CC19DCD7E|yonO]-[gene|3FFFA28E2C16508C6A94408B739864DB7F8DD1F7|yonN]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE21040 ([gene|34380A2F469ACFD90D450717A41D6F5CC19DCD7E|yonO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAATTCTCCCCTTATT, downstream forward: _UP4_TAGAAAGTGCCTTGAGCCTT
  • BKK21040 ([gene|34380A2F469ACFD90D450717A41D6F5CC19DCD7E|yonO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAATTCTCCCCTTATT, downstream forward: _UP4_TAGAAAGTGCCTTGAGCCTT
  • References

    Reviews

  • 30578347
  • Research papers

  • 28585540