SubtiBank SubtiBank
bltD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bltD

spermidine/ spermine acetyltransferase
locus
BSU26600
pI
6.09
mw
17.70 kDa
protein length
152 aa Sequence Blast
gene length
459 bp Sequence Blast
function
spermidine degradation
product
spermidine/ spermine acetyltransferase
essential
no
ec
2.3.1.57
synonyms
bmr2D,bmtD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.6|Metabolism of polyamines]
  • Gene

    Coordinates
    2,718,344 2,718,802

    The protein

    Catalyzed reaction/ biological activity

  • Acetyl-CoA + an alkane-alpha,omega-diamine = CoA + an N-acetyldiamine (according to Swiss-Prot)
  • Structure

  • [PDB|2FL4] (from Enterococcus faecalis, 45% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|B7C4BE1A252C6376B28C4FCC6EA9DCF3BC096405|blt]-[gene|34360353D4488F1081FEF9A3CF8F1866D271657D|bltD]
    description
    [Pubmed|7608059]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10200972], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|507E3E5493A88A0CD4CC0B8BE0EC3FCCA65493C7|BltR]: activation, [Pubmed|7608059], in [regulon|507E3E5493A88A0CD4CC0B8BE0EC3FCCA65493C7|BltR regulon]
  • [protein|A7326377132C670B60695EFE0A652B1E4F623698|Mta]: activation, [Pubmed|10200972], in [regulon|A7326377132C670B60695EFE0A652B1E4F623698|Mta regulon]
  • regulation

  • induced in the presence of polyamines [pubmed|29142164]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C455 (bltD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2453 NBRP B. subtilis, Japan]
  • BKE26600 ([gene|34360353D4488F1081FEF9A3CF8F1866D271657D|bltD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTACATTCTCCTTTTT, downstream forward: _UP4_TAGATATCCAAGCCTCCTTG
  • BKK26600 ([gene|34360353D4488F1081FEF9A3CF8F1866D271657D|bltD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTACATTCTCCTTTTT, downstream forward: _UP4_TAGATATCCAAGCCTCCTTG
  • References

  • 10359661,9083003,7608059,10200972