SubtiBank SubtiBank
yfnC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfnC

similar to fosmidmycin resistance protein
locus
BSU_07320
pI
9.80
mw
43.33 kDa
protein length
409 aa Sequence Blast
gene length
1230 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    803,317 804,546

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3416CB670B861D3F4ECFF87AE6E4397F6D7304FE|yfnC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C326 (yfnC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2324 NBRP B. subtilis, Japan]
  • BKE07320 ([gene|3416CB670B861D3F4ECFF87AE6E4397F6D7304FE|yfnC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAGTCTCCTCCTTACA, downstream forward: _UP4_TGAAAAAACCCCTGCCAGGC
  • BKK07320 ([gene|3416CB670B861D3F4ECFF87AE6E4397F6D7304FE|yfnC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAGTCTCCTCCTTACA, downstream forward: _UP4_TGAAAAAACCCCTGCCAGGC