SubtiBank SubtiBank
yqzL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqzL

unknown
locus
BSU_25289
pI
4.13
mw
5.70 kDa
protein length
gene length
144 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,609,750 2,609,893

    Expression and Regulation

    Operons

    genes
    [gene|0E9E9615CE056BEA2B65C494D946EB45F42A3064|cdd]-[gene|CB68B3393CA7862C45C624AF7B1ADD188243A01F|era]-[gene|33FBC31E8C24177137B0BDD8B46C1AFFD7F7B038|yqzL]-[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|6330116], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|6330116], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE25289 ([gene|33FBC31E8C24177137B0BDD8B46C1AFFD7F7B038|yqzL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25289 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGAAACCCACCTTTCT, downstream forward: _UP4_TAAACCTCTTGGCCGCTCCT
  • BKK25289 ([gene|33FBC31E8C24177137B0BDD8B46C1AFFD7F7B038|yqzL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25289 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGAAACCCACCTTTCT, downstream forward: _UP4_TAAACCTCTTGGCCGCTCCT