SubtiBank SubtiBank
yybC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yybC

unknown
locus
BSU_40690
pI
9.75
mw
17.43 kDa
protein length
159 aa Sequence Blast
gene length
480 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,181,982 4,182,461

    Expression and Regulation

    Operons

    genes
    [gene|9EC2800AF5B2B65BE3DEB4ABCCE7E448A24440DF|yybE]-[gene|DBEB1E43E1121D3D8AB6A0CA3BAF4072715F6577|yybD]-[gene|33C3EDF3709AC835C9C50B1B7978BA7C23EC9B9E|yybC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B851 (yybC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1850 NBRP B. subtilis, Japan]
  • BKE40690 ([gene|33C3EDF3709AC835C9C50B1B7978BA7C23EC9B9E|yybC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATCATTCCTTCTCT, downstream forward: _UP4_TAAATAGAAAAGGAGTGAGC
  • BKK40690 ([gene|33C3EDF3709AC835C9C50B1B7978BA7C23EC9B9E|yybC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATCATTCCTTCTCT, downstream forward: _UP4_TAAATAGAAAAGGAGTGAGC