SubtiBank SubtiBank
papA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

papA

Xaa-Pro amino-peptidase
locus
BSU_24460
pI
4.83
mw
37.96 kDa
protein length
353 aa Sequence Blast
gene length
1062 bp Sequence Blast
function
degradation of proline-containing peptides
product
Xaa-Pro amino-peptidase
essential
no
ec
3.4.11.9
synonyms
yqhT

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.4|Utilization of peptides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    Coordinates
    2,538,697 2,539,758

    Phenotypes of a mutant

  • inactivation of ''[gene|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]'' reduces sporulation efficiency to 1.2% that of wild type cells; delayed entry into sporulation [Pubmed|26735940]
  • The protein

    Protein family

  • peptidase M24B family (with [protein|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|PapB], according to UniProt)
  • Paralogous protein(s)

  • [protein|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|PapB]
  • Structure

  • [PDB|3Q6D] (the ''B. anthracis'' enzyme, 65% identity, 82% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|449EEBF33F52B461F244331ACD140E68CF64EE7C|yqhR]-[gene|D7503C73C0BC2E411C651E409E91C2E22E8842E5|yqhS]-[gene|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]-[gene|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|D7503C73C0BC2E411C651E409E91C2E22E8842E5|yqhS]-[gene|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]-[gene|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C447 (yqhT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2445 NBRP B. subtilis, Japan]
  • available in [SW|Erhard Bremer]'s lab
  • BKE24460 ([gene|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATCTTGATTCTCCCCC, downstream forward: _UP4_TGATTGGAATATAGGAGGAC
  • BKK24460 ([gene|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATCTTGATTCTCCCCC, downstream forward: _UP4_TGATTGGAATATAGGAGGAC
  • Expression vectors

  • pGP769: expression of Strep-''papA'' by [SW|pGP380] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • pGP1150: expression of ''papA''-Strep by [SW|pGP382] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Erhard Bremer], Marburg University, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi Homepage]
  • References

  • 23144141,26735940