SubtiBank SubtiBank
gerBA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerBA

nutrient receptor, germination response to the combination of glucose, fructose, and KCl
locus
BSU_35800
pI
7.30
mw
53.62 kDa
protein length
483 aa Sequence Blast
gene length
1452 bp Sequence Blast
function
germination response to the combination of glucose, fructose, and KCl
product
nutrient receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.1|Germinant receptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,688,812 3,690,263

    The protein

    Protein family

  • [SW|GerABKA family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|YfkQ], [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|YndD], [protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|GerKA], [protein|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|GerAA]
  • [SW|Localization]

  • spore inner membrane [Pubmed|21696470]
  • Expression and Regulation

    Operons

    genes
    [gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]-[gene|D70EC7C02BC79BED724489ABCB6356447F215B87|gerBB]-[gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]
    description
    [Pubmed|8012571]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,8012571], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,8012571]
  • additional information

  • 700 molecules are present per spore [PubMed|23749970]
  • view in new tab

    Biological materials

    Mutant

  • BKE35800 ([gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTTTCTCTCCTTCTTA, downstream forward: _UP4_AACATCAGACAAAGGTGATG
  • BKK35800 ([gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTTTCTCTCCTTCTTA, downstream forward: _UP4_AACATCAGACAAAGGTGATG
  • References

  • 10348844,12670969,15774895,7812448,11395462,16352818,8012571,21696470,23396907,24752279,16740944,26731423