SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


nutrient receptor, germination response to the combination of glucose, fructose, and KCl
53.62 kDa
protein length
483 aa Sequence Blast
gene length
1452 bp Sequence Blast
germination response to the combination of glucose, fructose, and KCl
nutrient receptor

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Germinant receptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,688,812 3,690,263

    The protein

    Protein family

  • gerABKA family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|YfkQ], [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|YndD], [protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|GerKA], [protein|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|GerAA]
  • [SW|Localization]

  • spore inner membrane [Pubmed|21696470]
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,8012571], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,8012571]
  • additional information

  • 700 molecules are present per spore [PubMed|23749970]
  • view in new tab

    Biological materials


  • BKE35800 ([gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTTTCTCTCCTTCTTA, downstream forward: _UP4_AACATCAGACAAAGGTGATG
  • BKK35800 ([gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTTTCTCTCCTTCTTA, downstream forward: _UP4_AACATCAGACAAAGGTGATG
  • References

  • 10348844,12670969,15774895,7812448,11395462,16352818,8012571,21696470,23396907,24752279,16740944,26731423