SubtiBank SubtiBank
conG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

conG

part of the ICEBs1 conjugation machinery, exclusion specificity factor
locus
BSU_04960
pI
6.29
mw
90.42 kDa
protein length
815 aa Sequence Blast
gene length
2448 bp Sequence Blast
function
conjugative transfer of ICEBs1
product
part of the ICEBs1 conjugation machinery
essential
no
synonyms
yddG

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    541,578 544,025

    Phenotypes of a mutant

  • resistant to exclusion of ICEBs1 [pubmed|31361051]
  • The protein

    [SW|Localization]

  • cell membrane, integral membrane protein [Pubmed|26013486]
  • Expression and Regulation

    Operons

    genes
    [gene|EE2A4068CBD7A2F852E582E2EDA4148381F1CD61|xis]-[gene|2227923C603B290AB276238F789D71584FB07DF3|ydzL]-[gene|34451538F10B4ABCFC8A236C8C905A20D989EBCF|ydcO]-[gene|C042792D9A643DCFF4A851EFECA3CF2C31E1EDAF|ydcP]-[gene|4BCAA5939CB7F0DF23495BC92C9EF0A0149296A0|ydcQ]-[gene|8E179976C35FE09F92A191D00E497ED4BF28F571|nicK]-[gene|886B2132717BA4C72433ABE351C5791C9DE1432A|S172]-[gene|1699CFBF5400CAF43C6DAE8ADCCE5A360B31F2E9|ydcS]-[gene|9D4918852A1856B1CDD72D49AEA75E51A8602BB6|ydcT]-[gene|62CEABA069CA2970F22B7E0C369D540A2A027A8D|yddA]-[gene|A0AFD543582D2FE8B1139CF69B7B1F7FF0F80265|conB]-[gene|F273A8817E66B44D58FC2BCB6576A30D8616B750|conC]-[gene|F1F898D7A9FDF78D2E5E8F3BF605E0F735D0542A|conD]-[gene|D20F724D8C3E8C758A9FADF133CD43F066BD8D48|conE]-[gene|B3A07E2A61151C33B7C65D1BC58B97BFDB76852D|yddF]-[gene|3356A43B83E2D4D66098F17A751F0912C1553398|conG]-[gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]-[gene|2E4FF80C857B3F40BA835814EC40D6562721AEFE|yddI]-[gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR]: repression, [Pubmed|17511812], in [regulon|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE04960 ([gene|3356A43B83E2D4D66098F17A751F0912C1553398|conG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCTTTTTCATTACAACCA, downstream forward: _UP4_CTGAGAAGGGATGAAAGAAC
  • BKK04960 ([gene|3356A43B83E2D4D66098F17A751F0912C1553398|conG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCTTTTTCATTACAACCA, downstream forward: _UP4_CTGAGAAGGGATGAAAGAAC
  • References

  • 26013486,31361051