SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


part of the ICEBs1 conjugation machinery, exclusion specificity factor
90.42 kDa
protein length
815 aa Sequence Blast
gene length
2448 bp Sequence Blast
conjugative transfer of ICEBs1
part of the ICEBs1 conjugation machinery

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    541,578 544,025

    Phenotypes of a mutant

  • resistant to exclusion of ICEBs1 [pubmed|31361051]
  • The protein


  • cell membrane, integral membrane protein [Pubmed|26013486]
  • Expression and Regulation



    regulatory mechanism

  • [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR]: repression, [Pubmed|17511812], in [regulon|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR regulon]
  • regulation

  • strongly induced in the presence of salt (1.2 M NaCl) [pubmed|32419322]
  • view in new tab

    Biological materials


  • BKE04960 ([gene|3356A43B83E2D4D66098F17A751F0912C1553398|conG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCTTTTTCATTACAACCA, downstream forward: _UP4_CTGAGAAGGGATGAAAGAAC
  • BKK04960 ([gene|3356A43B83E2D4D66098F17A751F0912C1553398|conG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCTTTTTCATTACAACCA, downstream forward: _UP4_CTGAGAAGGGATGAAAGAAC
  • References

  • 26013486,31361051