SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


buffering protein for development, dampens transitions to spore, biofilm exopolysaccharide and competence expression , targets [protein|search|ComK ]and [protein|search|ComS ]to the [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|search|ClpP ]degradation machine (in log phase), inhibits the transcriptional activity of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]-P by direct interaction
25.62 kDa
protein length
218 aa Sequence Blast
gene length
657 bp Sequence Blast
control of [protein|search|ComK ]degradation, regulation of competence
adaptor protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    1,229,068 1,229,724

    The protein

    Catalyzed reaction/ biological activity

  • recruits protein for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [pubmed|12598648]
  • inhibits transcription activation of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]-P (in complex with [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]) [pubmed|29446505]
  • Protein family

  • mecA family (with [protein|CE1C46944E242006383BA77B2C4E09045CB3B93F|YpbH], according to UniProt)
  • Paralogous protein(s)

  • [protein|CE1C46944E242006383BA77B2C4E09045CB3B93F|YpbH]
  • [SW|Domains]

  • N-terminal domain (1-120): recruitment of protein substrates [Pubmed|19801546]
  • C-terminal domain (121-218): facilitates assembly of the [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] oligomer and acts as a degradation tag [Pubmed|19801546]
  • Structure

  • [PDB|3PXG] (the [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA]-[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] complex) [pubmed|21368759]
  • [PDB|3J3U] (the [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA]-[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] complex) [Pubmed|23595989]
  • [PDB|3JTP](C-terminal domain) [Pubmed|19801546]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412687], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • GP813 (spc), GP814 (aphA3) both available in [SW|Jörg Stülke]'s lab
  • BKE11520 ([gene|331993A875907C10C77105FD8DDD86D4412CE405|mecA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAACCTTCCCTTC, downstream forward: _UP4_TAGCAAACCGATTTCCTTCC
  • BKK11520 ([gene|331993A875907C10C77105FD8DDD86D4412CE405|mecA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAACCTTCCCTTC, downstream forward: _UP4_TAGCAAACCGATTTCCTTCC
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 23375660,23479438,19609260
  • Original Publications

  • 11914365,9000055,17560370,19361434,9890793,2113920,8817496,8412687,11918817,10447896,12028382,8016067,10361283,11703662,9535081,19767395,19801546,8016066,19202088,8083167,21368759,23595989,16525504,12598648,21435029,29165246,29446505