SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


buffering protein for development, dampens transitions to spore, biofilm exopolysaccharide and competence expression , targets ComK and ComS to ClpC-ClpP degradation machine (in log Phase), inhibits the transcriptional activity of Spo0A?P by direct interaction
25.62 kDa
protein length
218 aa Sequence Blast
gene length
654 bp Sequence Blast
control of ComK degradation, regulation of competence
adaptor protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    1,229,068 → 1,229,724

    The protein

    Protein family

  • mecA family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|CE1C46944E242006383BA77B2C4E09045CB3B93F|YpbH]
  • [SW|Domains]

  • N-terminal domain (1 ... 120): recruitment of protein substrates [Pubmed|19801546]
  • C-terminal domain (121 ... 218): facilitates assembly of the [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] oligomer and acts as a degradation tag [Pubmed|19801546]
  • Structure

  • [ 3JTP] (C-terminal domain) [Pubmed|19801546]
  • [PDB|3PXG], [PDB|3J3U 3J3U] (the [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA]-[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] complex) [Pubmed|23595989]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412687], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • GP813 (spc), GP814 (aphA3) both available in the [SW|Stülke] lab
  • BKE11520 (Δ[gene|331993A875907C10C77105FD8DDD86D4412CE405|mecA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAACCTTCCCTTC, downstream forward: _UP4_TAGCAAACCGATTTCCTTCC
  • BKK11520 (Δ[gene|331993A875907C10C77105FD8DDD86D4412CE405|mecA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAACCTTCCCTTC, downstream forward: _UP4_TAGCAAACCGATTTCCTTCC
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 23375660,23479438,19609260
  • Original Publications

  • 11914365,9000055,17560370,19361434,9890793,2113920,8817496,8412687,11918817,10447896,12028382,8016067,10361283,11703662,9535081,19767395,19801546,8016066,19202088,8083167,21368759,23595989,16525504,12598648,21435029