SubtiBank SubtiBank
ylaL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylaL

unknown
locus
BSU_14820
pI
5.23
mw
17.75 kDa
protein length
161 aa Sequence Blast
gene length
486 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,550,797 1,551,282

    Expression and Regulation

    Operons

    genes
    [gene|330C4CEB4FEBE3D6E77A9A8582A23A12B8C6A55E|ylaL]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A541 (ylaL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/541 NBRP B. subtilis, Japan]
  • BKE14820 ([gene|330C4CEB4FEBE3D6E77A9A8582A23A12B8C6A55E|ylaL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATATGACCCCCTTCTC, downstream forward: _UP4_AAAGAGATCGAAATCATTTA
  • BKK14820 ([gene|330C4CEB4FEBE3D6E77A9A8582A23A12B8C6A55E|ylaL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATATGACCCCCTTCTC, downstream forward: _UP4_AAAGAGATCGAAATCATTTA