SubtiBank SubtiBank


5-methylthioribose-1-phosphate isomerase
38.70 kDa
protein length
353 aa Sequence Blast
gene length
1062 bp Sequence Blast
methionine salvage
5-methylthioribose-1-phosphate isomerase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    1,422,172 1,423,233

    The protein

    Catalyzed reaction/ biological activity

  • S-methyl-5-thio-α-D-ribose 1-phosphate --> 5-methylsulfanyl-D-ribulose 1-phosphate (according to UniProt)
  • Protein family

  • eIF-2B alpha/beta/delta subunits family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-80 and Arg-298 [Pubmed|22517742]
  • Structure

  • [PDB|2YVK]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12022921], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B320 (ykrS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13550 ([gene|32DD5C61F0F8147DEACBCBBE1283B4E2C88E96E9|mtnA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCAAATGAATGGGTCATGA, downstream forward: _UP4_TAAAAAACCGCTGGACTTTG
  • BKK13550 ([gene|32DD5C61F0F8147DEACBCBBE1283B4E2C88E96E9|mtnA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCAAATGAATGGGTCATGA, downstream forward: _UP4_TAAAAAACCGCTGGACTTTG
  • References

  • 11914366,11545674,15102328,12107147,12787499,18039762,22517742,15378759