SubtiBank SubtiBank
ydgK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydgK

similar to bicyclomycin resistance protein
locus
BSU_05680
pI
10.09
mw
42.52 kDa
protein length
402 aa Sequence Blast
gene length
1209 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    613,641 614,849

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • Bcr/CmlA family (single member, according to UniProt)
  • Structure

  • [PDB|2GFP] (from E. coli, 28% identity) [pubmed|16675700]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|327BF988C3D50598DF8F3CEEC62934A44E81767F|ydgK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C176 (ydgK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2174 NBRP B. subtilis, Japan]
  • BKE05680 ([gene|327BF988C3D50598DF8F3CEEC62934A44E81767F|ydgK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCAAACCTTCCCT, downstream forward: _UP4_TAAAAAAACCTGACATGACG
  • BKK05680 ([gene|327BF988C3D50598DF8F3CEEC62934A44E81767F|ydgK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCAAACCTTCCCT, downstream forward: _UP4_TAAAAAAACCTGACATGACG
  • References

    Research papers

  • 16675700