SubtiBank SubtiBank
yoeD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoeD

unknown
locus
BSU_18400
pI
4.09
mw
8.85 kDa
protein length
gene length
231 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,004,262 2,004,492

    Expression and Regulation

    Operons

    genes
    [gene|325FE4AF87F47F43F2C06AC9FAF107B6D3F54DEF|yoeD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B072 (yoeD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1071 NBRP B. subtilis, Japan]
  • BKE18400 ([gene|325FE4AF87F47F43F2C06AC9FAF107B6D3F54DEF|yoeD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAGCAGTCCCTTCTTA, downstream forward: _UP4_TAGGACACAATTTGAAATTG
  • BKK18400 ([gene|325FE4AF87F47F43F2C06AC9FAF107B6D3F54DEF|yoeD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAGCAGTCCCTTCTTA, downstream forward: _UP4_TAGGACACAATTTGAAATTG
  • References

  • 22383849