SubtiBank SubtiBank
ydjP
The papers of the month are back! Check them out! Link here

ydjP

similar to chloroperoxydase
locus
BSU06280
pI
4.62
mw
30.36 kDa
protein length
271 aa Sequence Blast
gene length
813 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    681,547 → 682,362

    The protein

    Paralogous protein(s)

  • [protein|AD4702CC69AC7D5FF391F14176881D582DD1C68A|YvaM]:
  • Structure

  • [PDB|4RNC] (from ''Rhodococcus sp.'', 28%(low identity!!!)
  • Expression and Regulation

    Operons

    genes
    [gene|D30ADD18D86E153482FE2BFC621230FEE5912BF9|yeaA]-[gene|322BE299860795A70EFA78B8E2614CCCC1CE7C87|ydjP]-[gene|1F845CE702BCD10F4DB596E438CE9DB076806B1D|ydjO]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • induced by cold shock [Pubmed|12399512]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C223 (ydjP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2221 NBRP B. subtilis, Japan]
  • BKE06280 (Δ[gene|322BE299860795A70EFA78B8E2614CCCC1CE7C87|ydjP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTCCTCCTTTAGT, downstream forward: _UP4_TAAAGAAAAAGGAATTAGGA
  • BKK06280 (Δ[gene|322BE299860795A70EFA78B8E2614CCCC1CE7C87|ydjP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTCCTCCTTTAGT, downstream forward: _UP4_TAAAGAAAAAGGAATTAGGA
  • References

  • 9987136