SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to chloroperoxydase
30.36 kDa
protein length
271 aa Sequence Blast
gene length
813 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    681,547 → 682,362

    The protein

    Paralogous protein(s)

  • [protein|AD4702CC69AC7D5FF391F14176881D582DD1C68A|YvaM]:
  • Structure

  • [PDB|4RNC] (from ''Rhodococcus sp.'', 28%(low identity!!!)
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • induced by cold shock [Pubmed|12399512]
  • view in new tab

    Biological materials


  • MGNA-C223 (ydjP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06280 (Δ[gene|322BE299860795A70EFA78B8E2614CCCC1CE7C87|ydjP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTCCTCCTTTAGT, downstream forward: _UP4_TAAAGAAAAAGGAATTAGGA
  • BKK06280 (Δ[gene|322BE299860795A70EFA78B8E2614CCCC1CE7C87|ydjP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCTCCTCCTTTAGT, downstream forward: _UP4_TAAAGAAAAAGGAATTAGGA
  • References

  • 9987136