SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


beta-galactosidase, has transgalactosylation activity
73.92 kDa
protein length
663 aa Sequence Blast
gene length
1992 bp Sequence Blast

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of pectin]
  • Gene

    774,799 776,790

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of terminal non-reducing beta-D-galactose residues in beta-D-galactosides (according to UniProt)
  • Protein family

  • glycosyl hydrolase 42 family (with [protein|DBBA549C2D71CF628E92AC7B659EA276E227D742|GanA], according to UniProt)
  • Structure

  • [PDB|1KWG] (from Thermus thermophilus, 31% identity) [pubmed|12215416]
  • Expression and Regulation



    regulatory mechanism

  • [protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR]: activation, [Pubmed|19651770], in [regulon|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR regulon]
  • regulation

  • induced by pectin ([protein|search|RhgR]) [Pubmed|19651770]
  • view in new tab

    Biological materials


  • MGNA-B455 (yesZ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07080 ([gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGATACAGTTTTCTCATCA, downstream forward: _UP4_TGATTCTTTGTATCGAATCA
  • BKK07080 ([gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGATACAGTTTTCTCATCA, downstream forward: _UP4_TGATTCTTTGTATCGAATCA
  • References

  • 19651770,17449691,17056685,12215416,30036621