SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


cell wall hydrolase (major autolysin) for cell elongation and separation, D,L-endopeptidase-type autolysin
37.16 kDa
protein length
334 aa Sequence Blast
gene length
1005 bp Sequence Blast
major autolysin, cell elongation and separation
cell wall hydrolase (major autolysin),endopeptidase-type autolysin

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Autolytic activity required for peptidoglycan synthesis (cell elongation)]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Autolysis]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Endopeptidases]
  • Gene

    1,018,998 1,020,002

    Phenotypes of a mutant

  • a ''[gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] [gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutant is not viable [Pubmed|17581128,22139507]
  • growth defect at high temperature [Pubmed|21541672]
  • inactivation of ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' strongly restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant by delaying cell lysis [Pubmed|22211522]
  • a ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutation is synthetically lethal with ''[gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]'' and ''[gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]'' mutation (due to a lack of autolysin activity) [Pubmed|23869552,23855774]
  • a ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutation increases the cell separation defect of a ''[gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]'' mutant [Pubmed|23855774]
  • cells are thinner (reduced diameter) as compared to the wild type [Pubmed|23869552]
  • reduced colony size with accumulation of dead cells in the colonies [pubmed|29114240]
  • The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
  • degradation of gamma-polyglutamic acid [pubmed|29458655]
  • Protein family

  • [SW|Peptidase C40 family] (according to UniProt)
  • [SW|Domains]

  • contains three N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|18430080]
  • C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507]
  • Effectors of protein activity

  • activity requires functional [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] and [protein|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|MreBH] [Pubmed|23869552,16950129]
  • both enzymatic activities are inhibited by interaction with [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|IseA] [pubmed|29458655]
  • Structure

  • [PDB|4XCM] (from Thermus thermophilus, 34% identity) [pubmed|25760608]
  • [SW|Localization]

  • binds the cell wall [Pubmed|21261835]
  • localizes to cell septa, poles and lateral sidewall of the cell (via the N-terminal domain) [Pubmed|22139507]
  • localization to lateral cell wall depends on the interaction with [protein|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|MreBH] [Pubmed|23869552]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9573210], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|9573210], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [Pubmed|21541672], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [Pubmed|24125693,17581128], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • induced at high temperature ([protein|search|SigI], [protein|search|WalR]) [Pubmed|24125693,21541672]
  • view in new tab

    Biological materials


  • 1A790 ( ''lytE''::''cat''), [Pubmed|9457885], available at [ BGSC]
  • 1A792 ( ''lytE''::''cat''), [Pubmed|1588906], available at [ BGSC]
  • 1A1024 ( ''lytE''::''spec''), [Pubmed|20400548], available at [ BGSC]
  • BKE09420 ([gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]::erm trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG
  • BKK09420 ([gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG
  • FLAG-tag construct

  • GP2020 ''lytE-3xFLAG spec'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References


  • 18430080,23066944,18266855
  • Original publications

  • 21261835,22211522,16950129,17581128,14594841,9457885,9573210,10322020,24125693,23199363,20059685,14651647,23869552,21541672,22139507,23855774,27118079,25760608,29114240,29458655,29914988,29458657,29465029