SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cell wall hydrolase (major autolysin) for cell elongation and separation, D,L-endopeptidase-type autolysin
37.16 kDa
protein length
334 aa Sequence Blast
gene length
1005 bp Sequence Blast
major autolysin, cell elongation and separation
cell wall hydrolase (major autolysin),endopeptidase-type autolysin

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Autolytic activity required for peptidoglycan synthesis (cell elongation)]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Autolysis]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Endopeptidases]
  • Gene

    1,018,998 1,020,002

    Phenotypes of a mutant

  • a ''[gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] [gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutant is not viable [Pubmed|17581128,22139507]
  • a [gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP] [gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE] double mutant has a severe [SW|cell shape] defect, thi can be suppressed by mutations resulting in reduced expression or activity of [protein|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PbpA] [pubmed|33087775]
  • growth defect at high temperature [Pubmed|21541672]
  • inactivation of ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' strongly restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant by delaying cell lysis [Pubmed|22211522]
  • synthetically lethal with ''[gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]'' and ''[gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]'' mutation (due to a lack of autolysin activity) [Pubmed|23869552,23855774]
  • synthetically lethal with [gene|0BC657B63EE124B17FDA7914262E706B2CC9ABC1|sweC] and [gene|5F184E491602D548AAE8E6D598BB742513770F73|sweD], this can be suppressed by point mutations in [gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE] or [gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX] [pubmed|31437162]
  • a ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutation increases the cell separation defect of a ''[gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]'' mutant [Pubmed|23855774]
  • cells are thinner (reduced diameter) as compared to the wild type [Pubmed|23869552]
  • reduced colony size with accumulation of dead cells in the colonies [pubmed|29114240]
  • The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
  • degradation of gamma-polyglutamic acid [pubmed|29458655]
  • Protein family

  • [SW|Peptidase C40 family] (according to UniProt)
  • [SW|Domains]

  • contains three N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|18430080]
  • C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507]
  • 3 [SW|LysM domain]s (aa 26-69, aa 86-129, aa 149-192) (according to UniProt)
  • Effectors of protein activity

  • activity requires functional [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] and [protein|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|MreBH] [Pubmed|23869552,16950129]
  • both enzymatic activities are inhibited by interaction with [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|IseA] [pubmed|29458655]
  • Structure

  • [PDB|4XCM] (from Thermus thermophilus, 34% identity) [pubmed|25760608]
  • [SW|Localization]

  • binds the cell wall [Pubmed|21261835]
  • localizes to cell septa, poles and lateral sidewall of the cell (via the N-terminal domain) [Pubmed|22139507]
  • localization to lateral cell wall depends on the interaction with [protein|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|MreBH] [Pubmed|23869552]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9573210], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|9573210], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [Pubmed|21541672], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [Pubmed|24125693,17581128], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expression is modulated in response to D,L-endopeptidase activity (increased two-fold to compensate for reduced activity in the absence of [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] or [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX], decreased upon overexpression of [protein|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|LytE]) ([protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]) [pubmed|31808740]
  • induced at high temperature ([protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI], [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]) [Pubmed|24125693,21541672]
  • view in new tab

    Biological materials


  • 1A790 ( ''lytE''::''cat''), [Pubmed|9457885], available at [ BGSC]
  • 1A792 ( ''lytE''::''cat''), [Pubmed|1588906], available at [ BGSC]
  • 1A1024 ( ''lytE''::''spec''), [Pubmed|20400548], available at [ BGSC]
  • BKE09420 ([gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]::erm trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG
  • BKK09420 ([gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG
  • FLAG-tag construct

  • GP2020 ''lytE-3xFLAG spec'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References


  • 18430080,23066944,18266855
  • Original publications

  • 21261835,22211522,16950129,17581128,14594841,9457885,9573210,10322020,24125693,23199363,20059685,14651647,23869552,21541672,22139507,23855774,27118079,25760608,29114240,29458655,29914988,29458657,29465029,31437162,31808740,33087775