SubtiBank SubtiBank
lytE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lytE

cell wall hydrolase (major autolysin) for cell elongation and separation, D,L-endopeptidase-type autolysin
locus
BSU09420
pI
10.71
mw
37.16 kDa
protein length
334 aa Sequence Blast
gene length
1005 bp Sequence Blast
function
major autolysin, cell elongation and separation
product
cell wall hydrolase (major autolysin),endopeptidase-type autolysin
essential
no
ec
3.4.-.-
synonyms
papQ,cwlF

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.2|Autolytic activity required for peptidoglycan synthesis (cell elongation)]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.4|Endopeptidases]
  • Gene

    Coordinates
    1,018,998 1,020,002

    Phenotypes of a mutant

  • a ''[gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] [gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutant is not viable [Pubmed|17581128,22139507]
  • growth defect at high temperature [Pubmed|21541672]
  • inactivation of ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' strongly restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant by delaying cell lysis [Pubmed|22211522]
  • a ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutation is synthetically lethal with ''[gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]'' and ''[gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]'' mutation (due to a lack of autolysin activity) [Pubmed|23869552,23855774]
  • a ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutation increases the cell separation defect of a ''[gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]'' mutant [Pubmed|23855774]
  • cells are thinner (reduced diameter) as compared to the wild type [Pubmed|23869552]
  • reduced colony size with accumulation of dead cells in the colonies [pubmed|29114240]
  • The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
  • degradation of gamma-polyglutamic acid [pubmed|29458655]
  • Protein family

  • [SW|Peptidase C40 family] (according to UniProt)
  • [SW|Domains]

  • contains three N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|18430080]
  • C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507]
  • Effectors of protein activity

  • activity requires functional [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] and [protein|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|MreBH] [Pubmed|23869552,16950129]
  • both enzymatic activities are inhibited by interaction with [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|IseA] [pubmed|29458655]
  • Structure

  • [PDB|4XCM] (from Thermus thermophilus, 34% identity) [pubmed|25760608]
  • [SW|Localization]

  • binds the cell wall [Pubmed|21261835]
  • localizes to cell septa, poles and lateral sidewall of the cell (via the N-terminal domain) [Pubmed|22139507]
  • localization to lateral cell wall depends on the interaction with [protein|40829C3632E9DCEB9E1C14A674B4B217F504CFE0|MreBH] [Pubmed|23869552]
  • Expression and Regulation

    Operons

    genes
    [gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]
    description
    [Pubmed|9573210]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9573210], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|9573210], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [Pubmed|21541672], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [Pubmed|24125693,17581128], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • induced at high temperature ([protein|search|SigI], [protein|search|WalR]) [Pubmed|24125693,21541672]
  • view in new tab

    Biological materials

    Mutant

  • 1A790 ( ''lytE''::''cat''), [Pubmed|9457885], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A790&Search=1A790 BGSC]
  • 1A792 ( ''lytE''::''cat''), [Pubmed|1588906], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A792&Search=1A792 BGSC]
  • 1A1024 ( ''lytE''::''spec''), [Pubmed|20400548], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1024&Search=1A1024 BGSC]
  • BKE09420 ([gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09420 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG
  • BKK09420 ([gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG
  • FLAG-tag construct

  • GP2020 ''lytE-3xFLAG spec'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 18430080,23066944,18266855
  • Original publications

  • 21261835,22211522,16950129,17581128,14594841,9457885,9573210,10322020,24125693,23199363,20059685,14651647,23869552,21541672,22139507,23855774,27118079,25760608,29114240,29458655,29914988,29458657,29465029