SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


spore germinant protein, essential for the transport of the 1:1 chelate of pyridine-2,6-dicarboxylic acid (DPA(2,6)) and Ca(2+)
12.00 kDa
protein length
116 aa Sequence Blast
gene length
351 bp Sequence Blast
spore germination
spore germinant protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • Gene

    2,440,423 2,440,773

    Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,1903432], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|15699190,1903432,8755877]
  • view in new tab

    Biological materials


  • BKE23402 ([gene|31D6CB7EC20C39C1815CA4552B8B9C4BE304E86B|spoVAEB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACAAAAGCCAAAAGGTAGT, downstream forward: _UP4_TTCAAACCGAAAGGATAATG
  • BKK23402 ([gene|31D6CB7EC20C39C1815CA4552B8B9C4BE304E86B|spoVAEB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACAAAAGCCAAAAGGTAGT, downstream forward: _UP4_TTCAAACCGAAAGGATAATG
  • labs

  • [SW|Peter Setlow], University of Connecticut Health Center, USA
  • References

  • 17573930,3114420,11751839,15451103,3926949,17158659,6432957,7934830,22328679,15699190,1903432,8755877,22343299