SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


PBSX prophage
49.93 kDa
protein length
466 aa Sequence Blast
gene length
1401 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,332,402 1,333,802

    The protein

    Protein family

  • myoviridae tail sheath protein family (with [protein|E8728725267F316B0DECC2AF316C3A35BC7A2F99|YqbK], according to UniProt)
  • Structure

  • [PDB|3LML] (from Listeria innocua, 52% identity)
  • [SW|Localization]

  • extracellular (no signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE12650 ([gene|31B1832E5EAD957EE6A5C7CB0C117EC0F26AA8AB|xkdK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTGTTGTAAATGTTCCGC, downstream forward: _UP4_TACTTTAATGTGGAGGTAAA
  • BKK12650 ([gene|31B1832E5EAD957EE6A5C7CB0C117EC0F26AA8AB|xkdK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTGTTGTAAATGTTCCGC, downstream forward: _UP4_TACTTTAATGTGGAGGTAAA
  • References

  • 2110147,8083174,18957862