SubtiBank SubtiBank
ytrC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytrC

[SW|ABC transporter] (hydrophobic protein, probably channel protein)
locus
BSU_30440
pI
7.74
mw
36.80 kDa
protein length
328 aa Sequence Blast
gene length
987 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (hydrophobic protein, probably channel protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,116,996 3,117,982

    The protein

    Protein family

  • ABC-5 integral membrane protein family (with [protein|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|YtrD], according to UniProt)
  • Paralogous protein(s)

  • [protein|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|YtrD]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF]
    description
    [Pubmed|10986249,21856850]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10986249,21856850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA]: repression, [Pubmed|10986249,21856850], in [regulon|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA regulon]
  • regulation

  • expressed early in the stationary phase [Pubmed|10986249]
  • view in new tab

    Biological materials

    Mutant

  • GP2646 Δ([gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF])::''ermC'', available in [SW|Jörg Stülke]'s lab
  • MGNA-B539 (ytrC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1538 NBRP B. subtilis, Japan]
  • BKE30440 ([gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30440 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CTCTCGATAGAGGAGACCTC, downstream forward: _UP4_TAAGAAATGCCTTAGGTTTG
  • BKK30440 ([gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCTCGATAGAGGAGACCTC, downstream forward: _UP4_TAAGAAATGCCTTAGGTTTG
  • References

  • 10986249,10092453,12399512