SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


site-specific DNA recombinase required for creating the sigK gene (excision of the skin element)
57.31 kDa
protein length
500 aa Sequence Blast
gene length
1503 bp Sequence Blast
excision of the skin element, creation of the sigK gene
site-specific DNA recombinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Excision of prophages]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,653,371 2,654,873

    The protein

    Protein family

  • N-terminal part: [SW|site-specific recombinase resolvase family] (according to UniProt)
  • [SW|Domains]

  • [SW|Resolvase/invertase-type recombinase catalytic domain] (aa 1-144) (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,2105293], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|7966271], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,2105293,7966271]
  • view in new tab

    Biological materials


  • BKE25770 ([gene|318618D2FB485EA2A08AD8468B1144ACC1CA2B99|spoIVCA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTGAATCTCCTTCCTA, downstream forward: _UP4_TTTCAATCAATCGGTGCAGA
  • BKK25770 ([gene|318618D2FB485EA2A08AD8468B1144ACC1CA2B99|spoIVCA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTGAATCTCCTTCCTA, downstream forward: _UP4_TTTCAATCAATCGGTGCAGA
  • References

  • 2163341,2105293,2841290,7966271