SubtiBank SubtiBank
spoIVCA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoIVCA

site-specific DNA recombinase required for creating the sigK gene (excision of the skin element)
locus
BSU_25770
pI
9.50
mw
57.31 kDa
protein length
500 aa Sequence Blast
gene length
1503 bp Sequence Blast
function
excision of the skin element, creation of the sigK gene
product
site-specific DNA recombinase
essential
no
synonyms
cisA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.1|Excision of prophages]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,653,371 2,654,873

    The protein

    Protein family

  • N-terminal part: [SW|site-specific recombinase resolvase family] (according to UniProt)
  • [SW|Domains]

  • [SW|Resolvase/invertase-type recombinase catalytic domain] (aa 1-144) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|318618D2FB485EA2A08AD8468B1144ACC1CA2B99|spoIVCA]
    description
    [Pubmed|2105293]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,2105293], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|7966271], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,2105293,7966271]
  • view in new tab

    Biological materials

    Mutant

  • BKE25770 ([gene|318618D2FB485EA2A08AD8468B1144ACC1CA2B99|spoIVCA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTGAATCTCCTTCCTA, downstream forward: _UP4_TTTCAATCAATCGGTGCAGA
  • BKK25770 ([gene|318618D2FB485EA2A08AD8468B1144ACC1CA2B99|spoIVCA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTGAATCTCCTTCCTA, downstream forward: _UP4_TTTCAATCAATCGGTGCAGA
  • References

  • 2163341,2105293,2841290,7966271