SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


site-specific DNA recombinase required for creating the sigK gene (excision of the skin element)
57.31 kDa
protein length
500 aa Sequence Blast
gene length
1503 bp Sequence Blast
excision of the skin element, creation of the sigK gene
site-specific DNA recombinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Excision of prophages]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,653,371 2,654,873

    The protein

    Protein family

  • [SW|site-specific recombinase resolvase family] (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,2105293], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|7966271], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,2105293,7966271]
  • view in new tab

    Biological materials


  • BKE25770 ([gene|318618D2FB485EA2A08AD8468B1144ACC1CA2B99|spoIVCA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTGAATCTCCTTCCTA, downstream forward: _UP4_TTTCAATCAATCGGTGCAGA
  • BKK25770 ([gene|318618D2FB485EA2A08AD8468B1144ACC1CA2B99|spoIVCA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTGAATCTCCTTCCTA, downstream forward: _UP4_TTTCAATCAATCGGTGCAGA
  • References

  • 2163341,2105293,2841290,7966271