SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


UDP glucose 4-epimerase
36.85 kDa
protein length
339 aa Sequence Blast
gene length
1020 bp Sequence Blast
galactose utilization
UDP glucose 4-epimerase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of galactose]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Matrix polysaccharide synthesis]
  • Gene

    3,989,948 3,990,967

    Phenotypes of a mutant

  • smooth colonies on MsGG medium, no [SW|biofilm formation] in the absence of externally provided galactose [Pubmed|22893383,22113911]
  • the mutant is sensitive to exogenous galactose due to the accumulation of toxic UDP-galactose, this sensitivity can be suppressed by the inactivation of ''[gene|36930CC6FDFCA23D43E264FEA375B78A1434E1BD|galK]'' (no formation of the toxic UDP-galactose) or of ''[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]'' (constitutive expression of the ''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]'' results in detoxification of UDP-galactose) [Pubmed|22893383]
  • The protein

    Catalyzed reaction/ biological activity

  • UDP-glucose = UDP-galactose (according to Swiss-Prot)
  • Protein family

  • [SW|NAD(P)-dependent epimerase/dehydratase family] (according to UniProt)
  • Structure

  • [PDB|1LRL] (from ''Escherichia coli Y299C mutant'', 57% identity, 71% similarity) [Pubmed|12019271]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9555917], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-B736 (galE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38860 ([gene|314223775ECB9E969F4F898584FC4E5379E86C7F|galE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTAAACCCTCCTAA, downstream forward: _UP4_TAAGAATGGAGGCCTTCTCA
  • BKK38860 ([gene|314223775ECB9E969F4F898584FC4E5379E86C7F|galE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTAAACCCTCCTAA, downstream forward: _UP4_TAAGAATGGAGGCCTTCTCA
  • References

  • 9555917,14597172,22893383,22113911,23033921,25954268