SubtiBank SubtiBank
ycsI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycsI

unknown
locus
BSU_04070
pI
6.41
mw
28.68 kDa
protein length
257 aa Sequence Blast
gene length
774 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    459,049 459,822

    The protein

    Protein family

  • D-glutamate cyclase family (single member, according to UniProt)
  • Structure

  • [PDB|3DB9] (from Agrobacterium tumefaciens, 57% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]-[gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]-[gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]-[gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]-[gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]-[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]-[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
    description
    [Pubmed|9334321]

    regulatory mechanism

  • [protein|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR]: repression, [Pubmed|9334321], in [regulon|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9334321], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced in the presence of 5-oxoproline [pubmed|28830929]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C023 (ycsI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2021 NBRP B. subtilis, Japan]
  • BKE04070 ([gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTTAATTGCTCCA, downstream forward: _UP4_TAGCCTCTCGTCATCCTGAT
  • BKK04070 ([gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTTAATTGCTCCA, downstream forward: _UP4_TAGCCTCTCGTCATCCTGAT
  • References

  • 9334321,25755103