SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


3-hydroxyacyl-CoA dehydratase
27.40 kDa
protein length
258 aa Sequence Blast
gene length
777 bp Sequence Blast
fatty acid degradation
3-hydroxyacyl-CoA dehydratase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of fatty acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,917,166 2,917,942

    The protein

    Catalyzed reaction/ biological activity

  • (3S)-3-hydroxyacyl-CoA = trans-2(or 3)-enoyl-CoA + H2O (according to Swiss-Prot)
  • Protein family

  • enoyl-CoA hydratase/isomerase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|25B45D6A90AD5152FDA71718B14767EA86ECA15B|YhaR]:
  • Modification

  • phosphorylated on Arg-230 [Pubmed|22517742]
  • Structure

  • [PDB|3PEA] (from ''B. anthracis'', 49% identity, 66% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21398533], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|21398533], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by long chain acyl-CoA (C14 ... C20) ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • expression of the operon is strongly induced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab



  • induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials


  • MGNA-B009 (ysiB::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A854 ( ''fadB''::''cat''), [Pubmed|17085570], available at [ BGSC]
  • BKE28540 ([gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCATTCATAGGACAGAACT, downstream forward: _UP4_GGCGAATAAAAGGGGATATG
  • BKK28540 ([gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCATTCATAGGACAGAACT, downstream forward: _UP4_GGCGAATAAAAGGGGATATG
  • References

  • 12850135,17189250,17919287,22517742