SubtiBank SubtiBank
fadB
The papers of the month are back! Check them out! Link here

fadB

3-hydroxyacyl-CoA dehydratase
locus
BSU28540
pI
4.95
mw
27.40 kDa
protein length
258 aa Sequence Blast
gene length
774 bp Sequence Blast
function
fatty acid degradation
product
3-hydroxyacyl-CoA dehydratase
essential
no
ec
4.2.1.17
synonyms
ysiB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.3|Utilization of fatty acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,917,166 → 2,917,942

    The protein

    Catalyzed reaction/ biological activity

  • (3S)-3-hydroxyacyl-CoA = trans-2(or 3)-enoyl-CoA + H2O (according to Swiss-Prot)
  • Protein family

  • enoyl-CoA hydratase/isomerase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|25B45D6A90AD5152FDA71718B14767EA86ECA15B|YhaR]:
  • Modification

  • phosphorylated on Arg-230 [Pubmed|22517742]
  • Structure

  • [PDB|3PEA] (from ''B. anthracis'', 49% identity, 66% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|7AC5217CA35F8E134ABB35D74F1BA5E684D2E058|lcfA]-[gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]-[gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]-[gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]-[gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]
    description
    [Pubmed|17189250]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21398533], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|21398533], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by long chain acyl-CoA (C14 ... C20) ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • view in new tab

    genes
    [gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]-[gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]-[gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]-[gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]
    description
    [Pubmed|17189250]

    regulation

  • induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B009 (ysiB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1008 NBRP B. subtilis, Japan]
  • 1A854 ( ''fadB''::''cat''), [Pubmed|17085570], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A854&Search=1A854 BGSC]
  • BKE28540 (Δ[gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCATTCATAGGACAGAACT, downstream forward: _UP4_GGCGAATAAAAGGGGATATG
  • BKK28540 (Δ[gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCATTCATAGGACAGAACT, downstream forward: _UP4_GGCGAATAAAAGGGGATATG
  • References

  • 12850135,17189250,17919287,22517742