SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


class I heat-shock protein (molecular chaperone)
65.83 kDa
protein length
611 aa Sequence Blast
gene length
1836 bp Sequence Blast
protein quality control
class I heat-shock protein (molecular chaperone)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.2|Chaperones/ protein folding]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    2,626,112 2,627,947

    The protein

    Protein family

  • heat shock protein 70 family (single member, according to UniProt)
  • Modification

  • phosphorylated on Tyr-601 by [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA], dephosphorylated by [protein|CF73D86DB024575BE8F043A4C3996458F4262E46|PtpZ] [Pubmed|27148221,17726680]
  • Structure

  • [PDB|2V7Y] (from ''Geobacillus kaustophilus'', 87% identity) [Pubmed|18400763]
  • [PDB|4ANI] ([protein|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|DnaK]-[protein|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|GrpE] complex from ''Geobacillus kaustophilus'', 87% identity) [Pubmed|22544739]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • membrane-proximal (Spotty) [Pubmed|16479537]
  • recruited to the membrane after ethanol stress [Pubmed|22268681]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1339421], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA]: repression, [Pubmed|1339421], in [regulon|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA regulon]
  • regulation

  • induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
  • view in new tab

    Biological materials


  • BKE25470 ([gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGAATAACCTCCTGCT, downstream forward: _UP4_TAAGTTCTTTTTAGTGTCAG
  • BKK25470 ([gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGAATAACCTCCTGCT, downstream forward: _UP4_TAAGTTCTTTTTAGTGTCAG
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 1339421,12224648,10383760,9023197,7540247,7592421,16479537,1339421,17726680,22268681,15378759,22544739,18400763,27148221