SubtiBank SubtiBank
yraF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yraF

forespore-specific sporulation protein, similar to spore coat protein
locus
BSU26960
pI
5.14
mw
13.87 kDa
protein length
122 aa Sequence Blast
gene length
369 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.2|Spore coat protein/ based on similarity]
  • Gene

    Coordinates
    2,753,065 2,753,433

    The protein

    Protein family

  • cotF family (according to Swiss-Prot)
  • [SW|Localization]

  • spore wall (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]-[gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]-[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]-[gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]-[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A028 (yraF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/28 NBRP B. subtilis, Japan]
  • BKE26960 ([gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCAAAGAGGCTTACCTCC, downstream forward: _UP4_CACTAACACTGGAGGTTTTA
  • BKK26960 ([gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCAAAGAGGCTTACCTCC, downstream forward: _UP4_CACTAACACTGGAGGTTTTA
  • References

  • 16497325