SubtiBank SubtiBank
yraF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yraF

forespore-specific sporulation protein, similar to spore coat protein
locus
BSU_26960
pI
5.14
mw
13.87 kDa
protein length
122 aa Sequence Blast
gene length
369 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.2|Spore coat protein/ based on similarity]
  • Gene

    Coordinates
    2,753,065 2,753,433

    The protein

    Protein family

  • [SW|CotF family] (according to UniProt)
  • [SW|Localization]

  • spore wall (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]-[gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]-[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]-[gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]-[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A028 (yraF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/28 NBRP B. subtilis, Japan]
  • BKE26960 ([gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCAAAGAGGCTTACCTCC, downstream forward: _UP4_CACTAACACTGGAGGTTTTA
  • BKK26960 ([gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCAAAGAGGCTTACCTCC, downstream forward: _UP4_CACTAACACTGGAGGTTTTA
  • References

  • 16497325