SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


extracellular neutral protease B
56.35 kDa
protein length
521 aa Sequence Blast
gene length
1566 bp Sequence Blast
degradation of proteins
extracellular neutral protease B

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of proteins]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Extracellular feeding proteases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,540,036 1,541,601

    The protein

    Catalyzed reaction/ biological activity

  • Similar, but not identical, to that of thermolysin (according to UniProt)
  • Protein family

  • peptidase M4 family (with [protein|57139471EB143F6DCCF092DAD0FBB43B0D50D948|NprB], according to UniProt)
  • Paralogous protein(s)

  • [protein|57139471EB143F6DCCF092DAD0FBB43B0D50D948|NprB]
  • Structure

  • [PDB|1NPC] (of ''Bacillus cereus'')
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|1906467], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|26728191], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during exponential growth ([protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]) [Pubmed|1906467]
  • additional information

  • in a triple ''[SW|abrB] [SW|codY] [SW|scoC]'' mutant, expression occurs during exponential growth [Pubmed|26728191]
  • view in new tab

    Biological materials


  • KO7 (''nprE aprE epr mpr nprB vpr bpr''), available as BGSC 1A1133
  • BKE14700 ([gene|309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF|nprE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAATCCCCCTTTTT, downstream forward: _UP4_TAATATTAGGAAAAGCCTGA
  • BKK14700 ([gene|309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF|nprE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAATCCCCCTTTTT, downstream forward: _UP4_TAATATTAGGAAAAGCCTGA
  • References


  • 20735481
  • Original publications

  • 1906467,18957862,20817675,24115457,26728191