SubtiBank SubtiBank
aag

aag

hypoxanthine-DNA glycosylase, general stress protein, required for protection against paraquat stress
locus
BSU_38620
pI
6.12
mw
21.98 kDa
protein length
196 aa Sequence Blast
gene length
591 bp Sequence Blast
function
DNA repair, survival of stress conditions
product
hypoxanthine-DNA glycosylase
essential
no
synonyms
yxlJ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,964,278 3,964,868

    Phenotypes of a mutant

  • increased sensitivity of sporulating cells to the genotoxic effects of MMS [Pubmed|27698084]
  • The protein

    Catalyzed reaction/ biological activity

  • removes hypoxanthine, 3-alkylated purines, and 1,N6-ethenoadenine from DNA; hypoxanthine and 1,N6-ethenoadenine are the preferred substrates [Pubmed|14729667]
  • protects sporulating cells from cytotoxic and genotoxic effects of MMS [Pubmed|27698084]
  • Protein family

  • DNA glycosylase MPG family (single member, according to UniProt)
  • Structure

  • [PDB|3QI5] (the human enzyme in complex with DNA, 33% identity) [pubmed|21349833]
  • [SW|Localization]

  • forespore [Pubmed|27698084]
  • Expression and Regulation

    Operons

    genes
    [gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]-[gene|9A30DA670D03D63C59DEB54EA7BD6DCEDDBD561A|yxzF]
    description
    [Pubmed|8990303]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|27698084], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during [SW|sporulation] in the forespore [SW|SigG] [Pubmed|27698084]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B756 (yxlJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1755 NBRP B. subtilis, Japan]
  • BKE38620 ([gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAATCGACCTCTCCTTT, downstream forward: _UP4_TAGCATGTTTAAGGAAGAGG
  • BKK38620 ([gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAATCGACCTCTCCTTT, downstream forward: _UP4_TAGCATGTTTAAGGAAGAGG
  • References

    Reviews

  • 22933559
  • Original publications

  • 15805528,14729667,22582280,27698084,21349833