SubtiBank SubtiBank
aag
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

aag

hypoxanthine-DNA glycosylase, general stress protein, required for protection against paraquat stress
locus
BSU38620
pI
6.12
mw
21.98 kDa
protein length
196 aa Sequence Blast
gene length
591 bp Sequence Blast
function
DNA repair, survival of stress conditions
product
hypoxanthine-DNA glycosylase
essential
no
synonyms
yxlJ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,964,278 3,964,868

    Phenotypes of a mutant

  • increased sensitivity of sporulating cells to the genotoxic effects of MMS [Pubmed|27698084]
  • The protein

    Catalyzed reaction/ biological activity

  • removes hypoxanthine, 3-alkylated purines, and 1,N6-ethenoadenine from DNA; hypoxanthine and 1,N6-ethenoadenine are the preferred substrates [Pubmed|14729667]
  • protects sporulating cells from cytotoxic and genotoxic effects of MMS [Pubmed|27698084]
  • Protein family

  • DNA glycosylase MPG family (according to Swiss-Prot) AAG family of 3-methyladenine DNA glycosylases
  • Structure

  • [PDB|3QI5] (the human enzyme in complex with DNA, 33% identity) [pubmed|21349833]
  • [SW|Localization]

  • forespore [Pubmed|27698084]
  • Expression and Regulation

    Operons

    genes
    [gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]-[gene|9A30DA670D03D63C59DEB54EA7BD6DCEDDBD561A|yxzF]
    description
    [Pubmed|8990303]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|27698084], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during [SW|sporulation] in the forespore [SW|SigG] [Pubmed|27698084]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B756 (yxlJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1755 NBRP B. subtilis, Japan]
  • BKE38620 ([gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAATCGACCTCTCCTTT, downstream forward: _UP4_TAGCATGTTTAAGGAAGAGG
  • BKK38620 ([gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAATCGACCTCTCCTTT, downstream forward: _UP4_TAGCATGTTTAAGGAAGAGG
  • References

    Reviews

  • 22933559
  • Original publications

  • 15805528,14729667,22582280,27698084,21349833