SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


9.15 kDa
protein length
gene length
240 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,461,621 2,461,860

    Expression and Regulation


    view in new tab

    view in new tab


    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|15469515,16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced upon DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|15469515,16267290]
  • view in new tab

    Biological materials


  • BKE23650 ([gene|30363923724EBD39C27967B25B486C71453190D1|yqkC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTTGTTCCACGTTTCGCG, downstream forward: _UP4_TAACATAAAAAAGCGAAAGA
  • BKK23650 ([gene|30363923724EBD39C27967B25B486C71453190D1|yqkC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTTGTTCCACGTTTCGCG, downstream forward: _UP4_TAACATAAAAAAGCGAAAGA