SubtiBank SubtiBank
oppA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

oppA

oligopeptide ABC transporter (binding protein)
locus
BSU11430
pI
5.72
mw
61.32 kDa
protein length
545 aa Sequence Blast
gene length
1638 bp Sequence Blast
function
initiation of sporulation, competence development
product
oligopeptide ABC transporter (binding protein)
essential
no
synonyms
spo0KA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.3|Uptake of peptides]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.4|Utilization of peptides]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    Coordinates
    1,219,849 1,221,486

    The protein

    Catalyzed reaction/ biological activity

  • required for the uptake of quorum sensing peptides such as [protein|4FA7D6E6316A6FC71C10C692D125833263894020|PhrH] [Pubmed|21908671]
  • Protein family

  • bacterial solute-binding protein 5 family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|853C570CFB9382449A20BE77B44B4FE44972AA59|DppE]
  • Modification

  • phosphorylation on (Tyr-301 OR Tyr-303) AND Thr-470 [Pubmed|17218307]
  • Structure

  • [PDB|1OLA] (from Salmonella enterica, 36% identity) [pubmed|8202710]
  • [SW|Localization]

  • attached to the cell membrane (via [protein|B0A3C7B253FB1DA1D4BC9D1D564905ECE8A65BC1|OppB]-[protein|DDBCE73B6AF39E5D669475479186C93F287DA9FC|OppC]) [Pubmed|10092453]
  • at the outer side of the cell: extracellular (signal peptide) [Pubmed|18957862], lipid modification as retention signal [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|302DFA46D73E18C4663468ED6033C55056744475|oppA]-[gene|B0A3C7B253FB1DA1D4BC9D1D564905ECE8A65BC1|oppB]-[gene|DDBCE73B6AF39E5D669475479186C93F287DA9FC|oppC]-[gene|05752B9C4EA7ACD579D65D028B7DF1861F3840CB|oppD]-[gene|38AD697B6C9967B8BD7496E31264A21F6D0A9DEE|oppF]
    description
    [Pubmed|1901616]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, no derepression occurs, however, in a [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY] mutant, due to increased repression by [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC] [Pubmed|25966844], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|10383984], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|trpS]' and '[protein|search|oppA]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BP67 (spc) available in [SW|Fabian Commichau]'s lab
  • 1S118 ( ''oppA''::''spec''), [Pubmed|11267663], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S118&Search=1S118 BGSC]
  • GP2097 (D(''[gene|302DFA46D73E18C4663468ED6033C55056744475|oppA]-[gene|B0A3C7B253FB1DA1D4BC9D1D564905ECE8A65BC1|oppB]-[gene|DDBCE73B6AF39E5D669475479186C93F287DA9FC|oppC]-[gene|05752B9C4EA7ACD579D65D028B7DF1861F3840CB|oppD]-[gene|38AD697B6C9967B8BD7496E31264A21F6D0A9DEE|oppF]'')::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BKE11430 (''[gene|302DFA46D73E18C4663468ED6033C55056744475|oppA]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE11430 ([gene|302DFA46D73E18C4663468ED6033C55056744475|oppA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGCAAACCCCCTAA, downstream forward: _UP4_TAAGGCTACGTCTGAAAATA
  • BKK11430 ([gene|302DFA46D73E18C4663468ED6033C55056744475|oppA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCGCAAACCCCCTAA, downstream forward: _UP4_TAAGGCTACGTCTGAAAATA
  • References

  • 1901616,10092453,27231947,11267663,9252573,10960106,12823818,10383984,18957862,18763711,17218307,7997159,20525796,23651456,21908671,25755103,25966844,1899858,23199363,8202710