SubtiBank SubtiBank
ripX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ripX

site-specific integrase/recombinase, partitioning of the terminus region after replication
locus
BSU_23510
pI
10.00
mw
33.84 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
function
chromosome partitioning
product
site-specific integrase/recombinase
essential
no
synonyms
ykqM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
  • Gene

    Coordinates
    2,448,591 2,449,481

    The protein

    Catalyzed reaction/ biological activity

  • resolution of chromosome dimers by site specific recombination at the dif site (located close to the terminus region on the chromosome)
  • Protein family

  • [SW|phage integrase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|89746E312F20C81BE3CFDFCE7D99B01C375C198B|CodV]
  • Structure

  • [PDB|1A0P] (from ''E. coli'', 44% identity, complex with [protein|89746E312F20C81BE3CFDFCE7D99B01C375C198B|CodV]) [Pubmed|9311978]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • assembles on the chromosome at the dif site throughout the cell cycle [Pubmed|21239579]
  • Biological materials

    Mutant

  • MGNA-C414 (ripX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2412 NBRP B. subtilis, Japan]
  • 1A793 ( ''ripX''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A793&Search=1A793 BGSC]
  • 1A796 ( ''ripX''::''spec''), [Pubmed|11208805], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A796&Search=1A796 BGSC]
  • BKE23510 ([gene|301568A5255A31538F52C46D7711EDAB2BD9CE90|ripX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTATTTGATCTTTCACTC, downstream forward: _UP4_TAGCCGCAGGTGGCTGCGGC
  • BKK23510 ([gene|301568A5255A31538F52C46D7711EDAB2BD9CE90|ripX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTATTTGATCTTTCACTC, downstream forward: _UP4_TAGCCGCAGGTGGCTGCGGC
  • References

    Reviews

  • 23400100
  • Original publications

  • 10498718,16597952,11208805,21239579,11134515,9311978