SubtiBank SubtiBank
dltE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dltE

D-alanine transfer from undecaprenol-phosphate to the poly(glycerophosphate) chain, alanylation of teichoic acid provides some resistance against positively charged antimicrobial peptides
locus
BSU38540
pI
5.09
mw
28.12 kDa
protein length
252 aa Sequence Blast
gene length
759 bp Sequence Blast
function
biosynthesis of teichoic acid
product
D-alanine transfer from undecaprenol-phosphate to the poly(glycerophosphate) chain
essential
no
synonyms
ipa-1r

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.4|Biosynthesis of teichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.3|Biosynthesis of teichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    3,956,492 3,957,250

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Structure

  • [PDB|5FF9] (28% identity) [pubmed|27252378]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|459ED28A98F4EC7E8A9016C742DC8EB5C26B5E65|ywzH]-[gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA]-[gene|1B9BAEBE029BE9D4AD7E49C38B1E6DB5E8F4D4D3|dltB]-[gene|862D977CF1E185597329A1EF0915485F72482A03|dltC]-[gene|D178EC8A1FF22C99C437E01FC4843C5176564992|dltD]-[gene|2FB3F09DA60A40212FE20217A64DAE714AB807CF|dltE]
    description
    [Pubmed|29794222]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|7797557], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|14762009], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, [Pubmed|21926231], in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulatory mechanism

  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|7797557], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • expression is reduced in a [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV] mutant [Pubmed|21926231]
  • the mRNA is processed between [gene|459ED28A98F4EC7E8A9016C742DC8EB5C26B5E65|ywzH] and [gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE38540 ([gene|2FB3F09DA60A40212FE20217A64DAE714AB807CF|dltE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGATGTAACACCTCTT, downstream forward: _UP4_TAATTTCTCCTGCTTTTTTC
  • BKK38540 ([gene|2FB3F09DA60A40212FE20217A64DAE714AB807CF|dltE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGATGTAACACCTCTT, downstream forward: _UP4_TAATTTCTCCTGCTTTTTTC
  • References

  • 14762009,7797557,23980836,21856855,21926231,27252378